ID: 907390306

View in Genome Browser
Species Human (GRCh38)
Location 1:54153753-54153775
Sequence CTTTGTGTCCAACAGGAAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907390295_907390306 17 Left 907390295 1:54153713-54153735 CCCCGCACAAGGAGCTGGCGCTG 0: 1
1: 0
2: 1
3: 12
4: 118
Right 907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 181
907390293_907390306 22 Left 907390293 1:54153708-54153730 CCAGGCCCCGCACAAGGAGCTGG 0: 1
1: 1
2: 4
3: 28
4: 294
Right 907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 181
907390297_907390306 15 Left 907390297 1:54153715-54153737 CCGCACAAGGAGCTGGCGCTGCA 0: 1
1: 0
2: 4
3: 170
4: 4557
Right 907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 181
907390296_907390306 16 Left 907390296 1:54153714-54153736 CCCGCACAAGGAGCTGGCGCTGC 0: 1
1: 0
2: 0
3: 20
4: 226
Right 907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907390306 Original CRISPR CTTTGTGTCCAACAGGAAGC GGG Exonic
902207361 1:14878762-14878784 CATGGTGGCCAACAGGAAACTGG - Intronic
903162699 1:21500720-21500742 ATTTGCATCTAACAGGAAGCGGG + Intergenic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
906787115 1:48625837-48625859 CTTTGACTCCAGCAGAAAGCAGG - Intronic
907390306 1:54153753-54153775 CTTTGTGTCCAACAGGAAGCGGG + Exonic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
908705324 1:66947712-66947734 CTTTGGATATAACAGGAAGCTGG - Intronic
911766900 1:101688209-101688231 GTGTGTGTACATCAGGAAGCAGG - Intergenic
912801684 1:112723390-112723412 CTGTGTGTGCAACAGGCAGAGGG - Intronic
914252841 1:145935901-145935923 GTTTGAGTCCAAGAGGAAGCAGG + Exonic
916079558 1:161223887-161223909 ACTTGAGTGCAACAGGAAGCAGG + Intergenic
916754138 1:167752431-167752453 CTTTGTGTCCTACAGTGTGCAGG - Intronic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
920256981 1:204662106-204662128 CCTTCTGTCCAACAGGAAGAAGG + Intronic
920569887 1:207008610-207008632 CTCTGTATCCAGAAGGAAGCTGG + Intronic
920997922 1:211013081-211013103 CTTGCTGTCCAGCTGGAAGCAGG - Intronic
921585386 1:216940494-216940516 GGTTGTGACCAACAGGAGGCTGG + Intronic
921670882 1:217922598-217922620 CTTTGTGTCCAACAAGGACAAGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1064089269 10:12369597-12369619 CTATGTGTCAAAGAGGACGCCGG + Intronic
1066428780 10:35333460-35333482 TTTTCTGTCCTAAAGGAAGCTGG - Intronic
1066473582 10:35723079-35723101 CTTTGATTCCAAGAGGAACCAGG - Intergenic
1067131291 10:43567826-43567848 TTTTGTGTCAAAAAGGAAGTAGG + Intronic
1073530094 10:104222792-104222814 TTTTATATCCAGCAGGAAGCAGG + Intronic
1074450785 10:113558103-113558125 CTTTGTCTCCTGCTGGAAGCTGG - Intronic
1074751550 10:116591882-116591904 ATTGGTGTACAGCAGGAAGCGGG - Exonic
1076022445 10:127085173-127085195 CTTTTTGTACAACAGTAAGCAGG + Intronic
1080687798 11:34529850-34529872 CTTTGTGTCCATCATGAGCCAGG + Intergenic
1081491586 11:43573475-43573497 CATTGAATCCACCAGGAAGCCGG + Intronic
1081674922 11:44963203-44963225 CTTGGGGCCCAGCAGGAAGCTGG - Intergenic
1083352796 11:62043049-62043071 CTTTGAATAGAACAGGAAGCAGG - Intergenic
1083672113 11:64305565-64305587 TTTTGTGTCCTACAAGCAGCCGG + Intronic
1084147954 11:67275034-67275056 AGTTGTCTCCAGCAGGAAGCAGG - Intronic
1084753668 11:71221337-71221359 CCTTGTGCCCAACCAGAAGCTGG - Intronic
1085282824 11:75342033-75342055 CTATGTGTCAAGCAGGAAGTAGG - Intronic
1085451774 11:76638495-76638517 CTATGTGTCCAACACATAGCGGG - Intergenic
1086127991 11:83369456-83369478 CTTTGAATACAACAGGAGGCAGG + Intergenic
1086510937 11:87557107-87557129 CATTGTCTCCAAAAGGGAGCTGG - Intergenic
1086680798 11:89669390-89669412 TTTTGTGTCCAACAGAAAAATGG + Intergenic
1091134598 11:133177496-133177518 TTTCCTGTCCATCAGGAAGCAGG - Intronic
1092029675 12:5273901-5273923 TTTTGTCTCCAGCAGGCAGCTGG + Intergenic
1094458610 12:30668233-30668255 CTTTGTCTCCAAGAGAAAACAGG + Intronic
1096239377 12:49951444-49951466 CGTTGAGTCCAACAGAAACCTGG - Intronic
1099066731 12:77990121-77990143 CTTTCTGTGCAACAGAGAGCAGG - Intronic
1099946216 12:89247701-89247723 CTGTTTTTCCAACAGGAAGAAGG - Intergenic
1100613834 12:96215366-96215388 CCTTGTGGCCGACAGGAAGGAGG + Intronic
1102642480 12:114379240-114379262 CGTTGTGTGCAAGGGGAAGCAGG - Intronic
1106172370 13:27299020-27299042 CTTTCTGAACACCAGGAAGCTGG - Intergenic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1110233162 13:73187781-73187803 ATTTGTGTCAAACAGGAGTCTGG + Intergenic
1113649538 13:112026258-112026280 CTCTGGGCCCCACAGGAAGCGGG - Intergenic
1114532256 14:23403357-23403379 GATTCTGTCCAACAAGAAGCCGG - Exonic
1117667332 14:58070288-58070310 CTTTGAGTCAAAAAGGAAGGTGG + Intronic
1118566445 14:67146216-67146238 CTATGAGTCCAACAAGCAGCAGG - Intronic
1121385472 14:93518446-93518468 TTTTTTGTCCATCAGGATGCTGG + Intronic
1121876527 14:97458137-97458159 CTTCCCGTCCACCAGGAAGCGGG - Intergenic
1122791345 14:104185424-104185446 CTGCCTGTCCTACAGGAAGCCGG - Intergenic
1122868867 14:104624883-104624905 GCTTGTGTCCGCCAGGAAGCAGG + Intergenic
1126705379 15:51400904-51400926 CTCTCTGTCCAACAGGTGGCTGG - Intronic
1127870298 15:63067471-63067493 TTTTGTCTACATCAGGAAGCAGG - Intronic
1128333763 15:66773171-66773193 CTTTGGCTCCTAGAGGAAGCCGG - Intronic
1130218191 15:81992850-81992872 CATTGTGTTCAACAGGGAGTAGG + Intergenic
1130327389 15:82891628-82891650 CTTCCTATGCAACAGGAAGCAGG - Intronic
1133890224 16:9872167-9872189 CTTTGTTTCCAACAGCAAAATGG - Intronic
1135690651 16:24534761-24534783 CTTTGTCAGCAACAGGAAGGAGG + Intergenic
1137665820 16:50248305-50248327 CTTTGTGCCCATCAAGAAGGGGG - Intronic
1139038574 16:62977184-62977206 CTCCGTTTCCATCAGGAAGCAGG - Intergenic
1139579773 16:67865604-67865626 CCTTGGATCCAAAAGGAAGCTGG - Intronic
1139940669 16:70603065-70603087 CTATGTGGCCACCAGGGAGCTGG + Intronic
1140623360 16:76763233-76763255 CTTTGAGTCCTAGATGAAGCTGG - Intergenic
1142047031 16:87932152-87932174 CCTTGCATCCAACGGGAAGCAGG + Intronic
1144562312 17:16330830-16330852 CTTTGCGGCCAAGGGGAAGCTGG + Intronic
1150954125 17:69837168-69837190 GTTTGTGTTCAAGAAGAAGCTGG + Intergenic
1153341606 18:3980445-3980467 ATTTGTGTCCAAAATGAAGTGGG + Intronic
1154338652 18:13485417-13485439 CATCATGCCCAACAGGAAGCAGG - Intronic
1158495401 18:57950791-57950813 CACAGTGTCCAACAGAAAGCGGG - Intergenic
1160386777 18:78501662-78501684 GCTTGTGTCCGCCAGGAAGCAGG + Intergenic
1161383318 19:3977822-3977844 CTTGGTGGCCCACTGGAAGCCGG + Exonic
1162548363 19:11344771-11344793 CTTTGTATCTACCAGGAAGAAGG + Intronic
1163692996 19:18747141-18747163 TTTTGTTTCCAACAAGAAGGGGG - Intronic
1165892497 19:39122402-39122424 ATTTCTGTGCATCAGGAAGCAGG - Intergenic
925057290 2:864992-865014 CTGTGAGTCCAGCAGGTAGCTGG + Intergenic
925453417 2:3991103-3991125 CTAAGTGTTCAAGAGGAAGCAGG - Intergenic
926426882 2:12746338-12746360 CTGTCTATCCACCAGGAAGCTGG - Intergenic
927204280 2:20597196-20597218 CTCTGAGCCCAGCAGGAAGCAGG + Intronic
927248662 2:20978818-20978840 CTTTATTTCCAACAGGAAATAGG - Intergenic
930200328 2:48546552-48546574 CTTTGTGTCCCACAGAACACTGG + Intronic
930736850 2:54788228-54788250 CTTGCAGGCCAACAGGAAGCGGG - Intronic
933629560 2:84640254-84640276 CTTTCTGTGCCACAGGAAACGGG - Intronic
933779140 2:85789263-85789285 CTTAGTGTCTGACAGGCAGCTGG - Intergenic
935086084 2:99846647-99846669 ATTTGTGTCCCACAGTAAGATGG + Intronic
936527150 2:113249074-113249096 CGTTGTGTCCACCAGGAAGATGG - Intronic
937535422 2:122880531-122880553 GTTTGTGCCCATCAGGAAGTTGG + Intergenic
937851878 2:126643307-126643329 CTTTTTGGCCAACAGGAGACAGG - Intergenic
938591357 2:132739447-132739469 CTTGTTGTCCCACAGCAAGCAGG - Intronic
940198462 2:151123076-151123098 CTTTGTCTCCAAAAGAAAGGGGG + Intergenic
943575794 2:189629714-189629736 CTGTGTCTCCAACAGAAATCTGG + Intergenic
946482246 2:220068379-220068401 CTGTGTGTCCAACAAGAACAAGG + Intergenic
946667010 2:222060994-222061016 CTCTGTGCCCTACAGGAAGATGG - Intergenic
947720673 2:232367753-232367775 CTGTGTGTGCTACAGGGAGCAGG - Intergenic
947758187 2:232584318-232584340 CTTTGAGCCCATCATGAAGCTGG + Intergenic
947972998 2:234339641-234339663 GTTTGTTTCCAACGGGAACCAGG + Intergenic
948167031 2:235870843-235870865 CTTTAAGTACAGCAGGAAGCAGG - Intronic
948921970 2:241070059-241070081 CTATGTCCCCAACGGGAAGCTGG + Exonic
1168837645 20:888373-888395 CTTTCTGTCCACCAACAAGCTGG - Exonic
1169748861 20:8971021-8971043 ATTCTTGTCCAATAGGAAGCTGG + Intergenic
1171464920 20:25320569-25320591 CTTTGTGGCCCAGAGGAGGCTGG - Intronic
1172654550 20:36528838-36528860 GTTTATTTCAAACAGGAAGCTGG - Intergenic
1173399536 20:42712003-42712025 CATTGTGTTCAAGTGGAAGCAGG + Intronic
1176007960 20:62876456-62876478 CTAGGTGTCCCACAGGAAGACGG + Intergenic
1179168991 21:38958137-38958159 CTTTGAGGCCAAGAGGGAGCAGG + Intergenic
1179471740 21:41614853-41614875 CACCGTGTCCAACAGGGAGCAGG + Intergenic
1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG + Intronic
1180215907 21:46323807-46323829 CTTTGTGTCCACCAGGACAGCGG - Exonic
1180228973 21:46414857-46414879 CTGTGTGTCCAGCAGGAGGAGGG - Intronic
1181713597 22:24707322-24707344 CCTGGTGGCCAGCAGGAAGCTGG + Intergenic
1183717727 22:39543666-39543688 CTTTGAGCCCAGCAGGAAGATGG - Intergenic
1185148475 22:49151617-49151639 CTGTGTGTCCCACTGGAGGCAGG + Intergenic
950498089 3:13346374-13346396 CCATGTGTCAATCAGGAAGCAGG - Intronic
951378579 3:21954729-21954751 TTTTGAGTCCAACAGGAACATGG - Intronic
951615348 3:24537060-24537082 CTTTGTGAGCAATAGGAAACTGG + Intergenic
954850315 3:53594541-53594563 CTTTCTTTCCTACAGGAGGCAGG - Intronic
955792004 3:62597723-62597745 CTCTGTGTCCAATAGGATGGGGG - Intronic
957175745 3:76806304-76806326 CTGGGTGTGCAAGAGGAAGCAGG - Intronic
957520187 3:81309310-81309332 CTTTGTGGCAAGCAGAAAGCAGG + Intergenic
960727804 3:120688326-120688348 CTTTGTGTCAAAAAGAAACCAGG + Exonic
962368060 3:134798616-134798638 CTTTGTGTCCAGAAGGCAGGAGG - Intronic
964142799 3:153422443-153422465 CTTTGGCTGCAACAGGATGCTGG - Intergenic
969497618 4:7535054-7535076 CCTGGGGTCCAACAGGAATCAGG - Intronic
970282705 4:14475602-14475624 CTTTTTGTGCACCAGGAATCAGG - Intergenic
983052542 4:163065619-163065641 CTTTCTGTAAAACAGGAAGGAGG + Intergenic
984076943 4:175195071-175195093 CTTTCTGTGCAGCAGGCAGCAGG + Intergenic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
988378140 5:30465484-30465506 CTTTGTGGCCAGGAGAAAGCGGG + Intergenic
989658573 5:43772945-43772967 CATTATGTCAAACAGGAAGTAGG + Intergenic
992641822 5:78774386-78774408 ATTTGTGGCCATCAGGAAGCTGG - Intergenic
994502328 5:100595388-100595410 CTTTGTTTGCAAAAGGAAGGAGG + Intergenic
998560388 5:143166076-143166098 CCTTGTGCCCATCACGAAGCAGG - Intronic
999136490 5:149323463-149323485 CATGCTGTCCCACAGGAAGCTGG - Intronic
1001569217 5:172719167-172719189 CTTTTTGACCCACAGGAAGGAGG + Intergenic
1003395845 6:5751393-5751415 CTTTTTGCCCAACAGGAAAATGG - Intronic
1006898159 6:37483815-37483837 GTTTGTGTCCATGAGGCAGCTGG + Intronic
1007689049 6:43686773-43686795 CTTTGTGTACTCCTGGAAGCAGG - Intronic
1010472603 6:76247134-76247156 CTTTGTCCCAAATAGGAAGCAGG + Intergenic
1012642076 6:101631548-101631570 CTGTGTGTCCCAAAGGAAACAGG + Intronic
1013356704 6:109351542-109351564 CTTTCTGGCCAATAGGAAGGAGG + Intergenic
1013597909 6:111677370-111677392 AGATGTGTCCAAGAGGAAGCAGG - Intronic
1014052256 6:116968529-116968551 CCTTGTGTCCTGCAGGAAGAAGG + Intergenic
1014392929 6:120886340-120886362 CTTTGTGTCAAAAAGGGAGGTGG + Intergenic
1019037891 6:169077036-169077058 CTTCGTGTCCAGCAACAAGCTGG - Intergenic
1019526465 7:1482622-1482644 CGATGTGTCCACCAGGAAGGCGG + Exonic
1019773539 7:2898611-2898633 CTTGGTGTCATGCAGGAAGCAGG - Intergenic
1021811402 7:24405033-24405055 CTTTCTGTCAAACAGTAGGCTGG + Intergenic
1021921399 7:25489024-25489046 TTTTGTTTCTAACAGGAACCTGG - Intergenic
1026948001 7:74328374-74328396 CTTTGGGGCCACCAGGAAGCGGG + Intronic
1034044978 7:147918078-147918100 CTTTGAGACCCTCAGGAAGCAGG - Intronic
1034776285 7:153829770-153829792 TGTGGTGTCCAACAGGGAGCCGG + Intergenic
1036550009 8:9807372-9807394 CTTTACTTCCAAAAGGAAGCTGG + Intergenic
1036988514 8:13565553-13565575 CCTTATCTTCAACAGGAAGCTGG + Intergenic
1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG + Intronic
1038982390 8:32774190-32774212 CTTTGTGTCAAACAGAGAACAGG - Intergenic
1040976152 8:53196386-53196408 CTTTGTGTGTAAAATGAAGCAGG + Intergenic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1043501851 8:80866358-80866380 CTGTGTGTACAGCAGGAACCTGG + Intronic
1044527955 8:93273509-93273531 CCGTGGCTCCAACAGGAAGCTGG - Intergenic
1045189769 8:99871247-99871269 CTTTGTTCCCAGGAGGAAGCAGG + Intronic
1047677005 8:127213208-127213230 CTGTGTTGCTAACAGGAAGCAGG + Intergenic
1056220545 9:84447144-84447166 TTCTGTTTCCAGCAGGAAGCTGG + Intergenic
1056396468 9:86186018-86186040 CTTTGTATTCAAAAGGCAGCTGG + Intergenic
1056736928 9:89217822-89217844 GTTTGTGCACAACAGGAAGGAGG - Intergenic
1058842015 9:108919043-108919065 ATTTGTGTCCACCAGGTAGGAGG + Intronic
1059723821 9:116986718-116986740 CTTTGTGACCTTCAGCAAGCAGG - Intronic
1060030219 9:120208200-120208222 CCTGGTGTCCAACAGGCAGTGGG + Intergenic
1060231489 9:121828605-121828627 CTTTGTGTTCAACAGGGACGGGG - Intronic
1061200734 9:129137040-129137062 CTCTGAGCCCCACAGGAAGCAGG - Intronic
1061816663 9:133201455-133201477 CATGGTGTCCAACAGGTGGCTGG + Intergenic
1186906829 X:14119789-14119811 CTCTGTGTCCAAGAAGAAGAGGG + Intergenic
1188876279 X:35434193-35434215 CTTTTTATTCTACAGGAAGCAGG + Intergenic
1189102508 X:38206133-38206155 CTTACTCTCCAGCAGGAAGCTGG - Intronic
1189261492 X:39682136-39682158 CTTGGTGACCTGCAGGAAGCAGG - Intergenic
1190055280 X:47177953-47177975 CCTGGTGGCCAACAGGATGCAGG - Intronic
1190537434 X:51442855-51442877 GGTTGTGTCCACCAGGTAGCAGG + Intergenic
1191937161 X:66438218-66438240 CTCTGTGACCAACATGATGCTGG + Intergenic
1192021670 X:67399235-67399257 CTTTTTATCAAACAGGATGCTGG + Intergenic
1195895730 X:109744446-109744468 CTTTGTGACCAACTGGGAGAGGG + Intergenic
1199227900 X:145400083-145400105 CTTTGTGTTCAACATGAATGAGG - Intergenic
1199964684 X:152810284-152810306 ATTTCTGTCCCACAGGCAGCAGG + Intergenic