ID: 907391842

View in Genome Browser
Species Human (GRCh38)
Location 1:54163264-54163286
Sequence GTGAACAGTAGGAGGCCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907391842_907391849 -10 Left 907391842 1:54163264-54163286 CCCCTGGGCCTCCTACTGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 907391849 1:54163277-54163299 TACTGTTCACAGGCTCAGCAGGG 0: 1
1: 0
2: 4
3: 9
4: 155
907391842_907391851 26 Left 907391842 1:54163264-54163286 CCCCTGGGCCTCCTACTGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 907391851 1:54163313-54163335 AGCGAAGAGCTCAGAGAGAAGGG 0: 1
1: 0
2: 4
3: 27
4: 342
907391842_907391850 25 Left 907391842 1:54163264-54163286 CCCCTGGGCCTCCTACTGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 175
Right 907391850 1:54163312-54163334 CAGCGAAGAGCTCAGAGAGAAGG 0: 1
1: 0
2: 1
3: 28
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907391842 Original CRISPR GTGAACAGTAGGAGGCCCAG GGG (reversed) Intronic
901965706 1:12864067-12864089 GAGAACATTAGGAAGACCAGTGG + Intronic
901981105 1:13034445-13034467 GAGAACATTAGGAAGACCAGTGG + Intronic
902000982 1:13194485-13194507 GAGAACATTAGGAAGACCAGTGG - Intergenic
902020212 1:13340189-13340211 GAGAACATTAGGAAGACCAGTGG - Intergenic
902629622 1:17696938-17696960 GTGACCAGGAGGAGGCTGAGGGG + Exonic
904976411 1:34460362-34460384 GTGAAGAAACGGAGGCCCAGAGG + Intergenic
905807106 1:40884880-40884902 GTGGGCATCAGGAGGCCCAGAGG + Intergenic
906096656 1:43228671-43228693 AAGAATGGTAGGAGGCCCAGCGG - Intronic
907267665 1:53272603-53272625 GGAAACAGGAGGAGGCCCAGGGG - Intronic
907391842 1:54163264-54163286 GTGAACAGTAGGAGGCCCAGGGG - Intronic
909339735 1:74518331-74518353 GTGAACAGTAAGAGGCTATGTGG - Intronic
910468961 1:87530260-87530282 GTGAACAGGAGGAAGCTCACAGG + Intergenic
910866603 1:91793854-91793876 GGTAATAGTAGGAGGGCCAGAGG - Intronic
912696419 1:111845543-111845565 GAGAACAGGAGGAGACCCTGGGG - Intronic
914825557 1:151136219-151136241 GGGAGCAGTAGGGGGCACAGAGG - Intronic
916660179 1:166916174-166916196 GTGAGCAGCAGGGGTCCCAGGGG - Exonic
918614923 1:186533017-186533039 GGAAACAGTAGGCTGCCCAGAGG - Intergenic
1062960100 10:1567088-1567110 ACGAACAGTAGGAAGGCCAGTGG + Intronic
1062999299 10:1899585-1899607 GTGAACAGTAGCAGACTCAAGGG + Intergenic
1070783365 10:79149930-79149952 ATGAACGGTGGGAGGCCTAGAGG + Intronic
1072501499 10:96022843-96022865 GTGCACAGCAGGAGGCCCTGAGG + Intronic
1073419505 10:103413072-103413094 GTGAGCAGGAGGAGGCACACAGG - Intronic
1075041822 10:119114075-119114097 CTGCCCAGAAGGAGGCCCAGAGG + Intronic
1076141361 10:128080960-128080982 GTGAACAGAAGCAGGCACAAGGG - Intronic
1076994845 11:292860-292882 GGGAGCAGGAGGAGGCACAGAGG - Intronic
1079074146 11:17373224-17373246 GGGACCAGGAGGAGGCCCAGGGG + Exonic
1079441825 11:20522706-20522728 GTTCACAGTAGGAGGCTCATTGG - Intergenic
1079461213 11:20679792-20679814 ATGCACAGTAGGTGGCCCTGAGG - Intronic
1080443422 11:32315680-32315702 GTGAATAGCAGGAGGGACAGGGG - Intergenic
1080711471 11:34751969-34751991 GTGAATGGAAGGAGGCACAGGGG - Intergenic
1080729847 11:34938141-34938163 GTGAACAGAAGGACGACTAGAGG + Intronic
1081745500 11:45469955-45469977 GCCAGCAGTAGGAGTCCCAGAGG + Intergenic
1081963230 11:47153570-47153592 GTGAAGAGTCTGAGGCTCAGAGG - Intronic
1084496331 11:69505744-69505766 GTGTACACCAGGAGGCACAGAGG + Intergenic
1084534033 11:69746327-69746349 GAGATCAGGAGGAGGCGCAGAGG + Intergenic
1084597778 11:70127413-70127435 GTGAACAGCAGAAGGCACATCGG - Intronic
1085565482 11:77509513-77509535 ATGAACAGTAGGAGGCAAACTGG - Intergenic
1089959693 11:122604854-122604876 GGGAACAGGTGGAGGCACAGAGG + Intergenic
1090243588 11:125200603-125200625 GAGAACAGACGGAGGGCCAGGGG - Intronic
1091402491 12:189378-189400 GGGGAGAGAAGGAGGCCCAGGGG - Intergenic
1096283490 12:50277449-50277471 GTGAACAGTAGTAGCTCCAAAGG + Intronic
1099118873 12:78663273-78663295 GTGAACAGATAGATGCCCAGAGG + Intergenic
1099265171 12:80437288-80437310 GTGAAAAGGAGGACTCCCAGAGG + Intronic
1102062852 12:109947223-109947245 GTGAACAGCAGAAGCGCCAGTGG + Intronic
1103893330 12:124256078-124256100 GGGAACAGTAAGAGGTCCCGAGG - Intronic
1104035373 12:125093680-125093702 GTGAACAGTCCCAGGCCCTGCGG + Intronic
1104799515 12:131544192-131544214 GGGTACAGGAGGAGGCACAGGGG - Intergenic
1104847366 12:131853205-131853227 GTGAACCGTAGGCGGGGCAGGGG + Intergenic
1105675444 13:22666616-22666638 ATGAACAGTACGAGGCTTAGGGG - Intergenic
1114694667 14:24615202-24615224 GAGAGCAGCAGGAGCCCCAGGGG - Intergenic
1114988784 14:28262749-28262771 GTGATCAGGAGGAGGCAGAGTGG - Intergenic
1121405309 14:93716090-93716112 GAGAGCAGAAGGAGCCCCAGAGG + Intergenic
1121441256 14:93951015-93951037 GTGGACAGTTGGAGGCCTTGAGG - Exonic
1122452951 14:101825966-101825988 GAGAATAGGAGGTGGCCCAGAGG + Intronic
1122791064 14:104184386-104184408 GTGAACAGGAGGAGGCTCACAGG - Intergenic
1122943559 14:104994490-104994512 GAGAACACTAGGGGGCCGAGAGG + Intronic
1124529859 15:30496099-30496121 GAAACCAGTAGGAGCCCCAGTGG + Intergenic
1124768800 15:32511589-32511611 GAAACCAGTAGGAGCCCCAGTGG - Intergenic
1125685784 15:41562489-41562511 TTGTACAGTAGGAAGCCAAGAGG + Intronic
1128697583 15:69780139-69780161 GTGCACTGTAGGATGCCTAGCGG - Intergenic
1130633970 15:85598783-85598805 GGGAACAGTAGAAGGGACAGTGG - Intronic
1133452966 16:5918967-5918989 GTGGACACAAGGAGGCGCAGTGG + Intergenic
1134533805 16:15007606-15007628 GTAAGCTGTAGGAGTCCCAGGGG + Intronic
1137358112 16:47786375-47786397 GTGTACAGTAAGAGGCCAACTGG - Intergenic
1137637139 16:49996376-49996398 GAGACCAGCAGGAGCCCCAGAGG + Intergenic
1139862235 16:70033119-70033141 GTAAGCTGTAGGAGTCCCAGGGG - Intergenic
1140312540 16:73863386-73863408 GTGAACAGCAGGACGCCAAAAGG + Intergenic
1141747952 16:85938606-85938628 CTGAACAAGTGGAGGCCCAGAGG - Intergenic
1141785182 16:86194931-86194953 GTCCACAGTGGGAGGCTCAGGGG + Intergenic
1142161388 16:88559385-88559407 GGGAACACCAGGGGGCCCAGGGG - Intergenic
1143780641 17:9227005-9227027 GGGAACAGGAGGAGGCAGAGGGG - Intronic
1144088611 17:11833260-11833282 TTGAACAGTAAGAATCCCAGTGG - Intronic
1144661869 17:17076184-17076206 GTGAAGGGTTGGGGGCCCAGAGG + Intronic
1144796152 17:17892575-17892597 GGGACCAGAAGGATGCCCAGAGG - Intronic
1144956714 17:19022299-19022321 GTGGGCAGCAGGAGGCCCAGTGG - Intronic
1145888890 17:28400939-28400961 GTGGACAGTAGCTGGCACAGAGG + Exonic
1147749528 17:42721189-42721211 TTGAACACTAGGAGGCACTGTGG + Intronic
1148142448 17:45338368-45338390 GTGGATAGTAGGGGGCCCAGGGG + Intergenic
1149556702 17:57578536-57578558 GGGAACAGAAGAATGCCCAGGGG + Intronic
1150911728 17:69394886-69394908 GTGAACAGCAGGGGGCGTAGTGG - Intergenic
1151553994 17:74837465-74837487 CTGCACTGTAGGAGGCCCTGAGG - Exonic
1152045081 17:77930191-77930213 GTGGACATCAGGAGGCTCAGTGG - Intergenic
1152853484 17:82650356-82650378 GTGAACTGAAGGAGGCCCCAAGG - Intergenic
1154347232 18:13552161-13552183 GTGAACAATGTGAGGCACAGTGG + Intronic
1161021676 19:2014198-2014220 GTCACCAGTAGGGGTCCCAGGGG + Intronic
1165612657 19:37169816-37169838 GTGAGAAGGAGGAGTCCCAGGGG - Intronic
1167266623 19:48485954-48485976 AGGAACAGCAGGAGGCCCAGTGG - Intronic
1167771069 19:51518942-51518964 CTGAAAAGGAGTAGGCCCAGAGG - Intergenic
925008841 2:467305-467327 GTGAACAGGAGGAGGCTTTGGGG - Intergenic
925467873 2:4125836-4125858 GTGAGAAGTAGTAAGCCCAGGGG + Intergenic
926103580 2:10136517-10136539 GTCAACACTGGGAGGCCAAGGGG + Intergenic
926165948 2:10522261-10522283 GTGGACAGAAGGACGCCCTGAGG - Intergenic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
927496587 2:23555426-23555448 GGGAACAGAAGGAGCCCCTGGGG + Intronic
927643454 2:24860313-24860335 GGGTAGAGCAGGAGGCCCAGAGG - Intronic
928290187 2:30029869-30029891 GTGAAAAGCAAGAGGCACAGAGG + Intergenic
928394578 2:30933586-30933608 GTGAACAGCAGTAGGCAGAGGGG - Intronic
930202751 2:48560581-48560603 TTGGAGAGTAGGAAGCCCAGGGG + Intronic
935179273 2:100675583-100675605 GTGCACACTTGGAGGCCCACAGG - Intergenic
935271959 2:101442742-101442764 GGAACCAGTGGGAGGCCCAGAGG - Intronic
936269227 2:111036198-111036220 GGGAAGAGTGGGAGGACCAGAGG + Intronic
938109156 2:128552622-128552644 TTGAACATTATCAGGCCCAGCGG - Intergenic
941297562 2:163759221-163759243 GTGAACAGTAACAGGACCAACGG - Intergenic
945201678 2:207288214-207288236 GTGAACAGGAGGTGGCCCGAGGG + Intergenic
948059304 2:235031696-235031718 GTGAGAAGGAGGAGGCCCAGAGG - Intronic
948335225 2:237202138-237202160 GTGGATAGCAGGAGGCCCTGAGG + Intergenic
1168909449 20:1435491-1435513 ATGAAGAAAAGGAGGCCCAGAGG + Intergenic
1171377242 20:24701850-24701872 GTGTGCAGTAGGAGATCCAGGGG - Intergenic
1174034998 20:47663409-47663431 GTGGACAGGCTGAGGCCCAGGGG - Intronic
1174578693 20:51555674-51555696 GTGAACAGCAAGGAGCCCAGTGG - Intronic
1175137187 20:56833017-56833039 GTGGAGAATAGGAGCCCCAGGGG + Intergenic
1175868007 20:62191686-62191708 GTGTACAGAAGGGGCCCCAGTGG - Intronic
1176298649 21:5088148-5088170 GTAAACACTGGGAGGACCAGTGG - Intergenic
1179710157 21:43208712-43208734 GCGGACAGTGGGAGGCCCATAGG + Intergenic
1179858377 21:44173801-44173823 GTAAACACTGGGAGGACCAGTGG + Intergenic
1179916432 21:44480951-44480973 GTGAGCATGAGGAGCCCCAGAGG - Intergenic
1180090067 21:45529352-45529374 GTGACCAGCATAAGGCCCAGGGG + Intronic
1181421509 22:22802527-22802549 GTGGACAGCAGGAGGCACTGTGG + Intronic
1182352325 22:29705845-29705867 CTCAGCAGTGGGAGGCCCAGCGG + Intergenic
1184993226 22:48184420-48184442 CTGACCAAGAGGAGGCCCAGAGG - Intergenic
951709018 3:25571044-25571066 GTGACCAGGAGCAGGCCCAGAGG + Intronic
952749558 3:36814384-36814406 GAGAACAGGGGGAGGCCCATGGG - Intergenic
953413038 3:42700984-42701006 GTGAACTGTGGGGGGCACAGGGG - Intronic
953468593 3:43146987-43147009 GGGATCAGTGGGAGCCCCAGTGG + Intergenic
956469970 3:69556034-69556056 GTGAGCAGCAGGAGACACAGAGG + Intergenic
958037975 3:88192275-88192297 TTGAGCAGTAGGATGACCAGAGG + Intergenic
959066316 3:101660787-101660809 GTGTACTGTATGTGGCCCAGTGG - Intronic
960317036 3:116190852-116190874 GTGAACTCTAGGAAGACCAGTGG - Intronic
961285183 3:125796395-125796417 CTGAACAGTAGGATCCCTAGGGG - Intergenic
964508040 3:157421095-157421117 CTGAAAAGTAGGATGCCTAGAGG + Intronic
964794301 3:160480911-160480933 GTGAACAGTGGGTTGGCCAGGGG - Intronic
965492857 3:169361217-169361239 GTGCACAGGAGGAGGACTAGGGG - Intronic
968815743 4:2820775-2820797 GTGCACAGTAGGAGGGCATGGGG + Intronic
968900559 4:3429729-3429751 CTGGGCAGTGGGAGGCCCAGGGG + Intronic
968982463 4:3857669-3857691 GTGAAGAGTAGGAGGGACATGGG - Intergenic
969652147 4:8474230-8474252 GTGCTCAGGAGGAGCCCCAGGGG - Intronic
971015904 4:22488496-22488518 GTGAATTGTACGAGGCTCAGGGG - Intronic
973041196 4:45472157-45472179 GCAGACAGTAGGAGGCCCTGGGG - Intergenic
973611260 4:52637843-52637865 GAGAACAGCAGGAGGGCCATTGG - Intronic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976540471 4:86268547-86268569 GTGAACAGTAGAGGACCGAGGGG - Intronic
977376070 4:96205614-96205636 GTGAACAGTAGGGGACCTATGGG - Intergenic
978084597 4:104635199-104635221 GTGAACTGTAGCTGGCACAGTGG + Intergenic
981247302 4:142555234-142555256 GTGACCTGTAGAAGTCCCAGTGG - Intronic
984731190 4:183069546-183069568 GTTAACTGTAGGAGGCTCAGTGG - Intergenic
986321838 5:6637753-6637775 GTGCACAGTCAGATGCCCAGAGG + Intronic
991408151 5:66321632-66321654 TTGAACAGGAGGAGAACCAGTGG + Intergenic
994117683 5:96079218-96079240 GTGAAATGAAGGGGGCCCAGGGG - Intergenic
994220241 5:97187181-97187203 GTGAACACAAGCAGGACCAGAGG + Intergenic
997600210 5:135133929-135133951 GTGAGCAGGAGGAGGGACAGGGG + Intronic
1000868838 5:166549729-166549751 GTGAAGAAGAGGAGGCTCAGAGG + Intergenic
1002167239 5:177355822-177355844 GAGAAGATGAGGAGGCCCAGGGG - Intergenic
1002294310 5:178221686-178221708 GAGGAGAGGAGGAGGCCCAGAGG - Intronic
1004804134 6:19183585-19183607 GGGAACAGCAGGAGGCCTGGCGG + Intergenic
1015561095 6:134516937-134516959 GTGCCTAGTAGGGGGCCCAGAGG + Intergenic
1019645331 7:2125933-2125955 GTAAACGTGAGGAGGCCCAGGGG - Intronic
1021809547 7:24390086-24390108 GTAAAAAGTAGTAGGGCCAGTGG - Intergenic
1022553813 7:31271271-31271293 GTTAACAGAGGGAGGACCAGAGG + Intergenic
1024051596 7:45627329-45627351 GTGAAAGGTCAGAGGCCCAGTGG - Intronic
1026070290 7:67112779-67112801 GTGATAAGTGGGAGGCACAGGGG + Intronic
1026706620 7:72699490-72699512 GTGATAAGTGGGAGGCACAGGGG - Intronic
1027705434 7:81527775-81527797 GTGAACAGCAAAAGTCCCAGTGG - Intergenic
1028052955 7:86207836-86207858 GTGAACAGAATGAGCCCCATGGG - Intergenic
1030621766 7:111797990-111798012 GGGACCAGAAGGAGGCCCAAAGG + Intronic
1031413088 7:121464220-121464242 GTTTTCAGTAGGAGGACCAGAGG + Intergenic
1034417133 7:150971154-150971176 GAGAAGGGCAGGAGGCCCAGAGG + Intronic
1035094179 7:156340209-156340231 GTGAACAGGAGGAACCCAAGAGG + Intergenic
1035765092 8:2099203-2099225 GGGCAGAGTAGGAGGCCCTGAGG + Intronic
1036592112 8:10178195-10178217 GTGAAAATCAGGAGACCCAGGGG + Intronic
1037404881 8:18531618-18531640 GAGCAAGGTAGGAGGCCCAGAGG + Exonic
1038643337 8:29344593-29344615 GTGAGAAGGAGGAGGCACAGTGG - Intronic
1047118438 8:121871984-121872006 ATGAACAGTTGGAGGCTTAGGGG - Intergenic
1047513272 8:125531549-125531571 TTGAAATGTAGGACGCCCAGTGG - Intergenic
1047523528 8:125613828-125613850 GTGCACAGTAAGAGCTCCAGAGG + Intergenic
1049773834 8:144395718-144395740 ATGGACAGGAGGAGCCCCAGAGG - Intronic
1052984706 9:34478298-34478320 GTGTACAATAGGAAGACCAGAGG + Intronic
1056714813 9:89020442-89020464 GGGACCTGAAGGAGGCCCAGAGG - Intronic
1057824391 9:98360935-98360957 GTGGACAGAACGAGGCACAGTGG - Intronic
1058630300 9:106979477-106979499 TTAAAAAGTAGGAGGCCAAGAGG - Intronic
1058805162 9:108583498-108583520 GTGAACAGATGGAGGCCAGGGGG - Intergenic
1059981953 9:119783050-119783072 GTGCAGAGTCAGAGGCCCAGAGG + Intergenic
1060042113 9:120308702-120308724 GTCAACATCAGGAGGCCTAGAGG - Intergenic
1060749201 9:126157730-126157752 TTGAGCAGTAGGAAACCCAGGGG + Intergenic
1187122566 X:16423455-16423477 GTGAATTGTAGGTGACCCAGAGG + Intergenic
1192358224 X:70423054-70423076 GGGAACAGGAGGAGGGACAGAGG + Exonic
1195509870 X:105702633-105702655 ATGAAAAGTATGAGGCCCACTGG + Intronic
1200796554 Y:7346200-7346222 GAGAACAGGAGGAGCCCCAGAGG - Intergenic