ID: 907393557

View in Genome Browser
Species Human (GRCh38)
Location 1:54174400-54174422
Sequence CCTACTATGTAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907393557_907393569 24 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG 0: 1
1: 0
2: 4
3: 21
4: 311
907393557_907393565 5 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393557_907393566 6 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393557_907393567 7 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907393557 Original CRISPR CCTACTATGTAGAAGGAGGA TGG (reversed) Exonic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
901932132 1:12602559-12602581 TCTAATATGCAGAAGGAGAAGGG + Intronic
906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909680660 1:78287810-78287832 CCTACTATGTGGAAGAAGTGGGG + Intergenic
912977152 1:114341182-114341204 CCTACTGTGTGGAAGGAACATGG + Intergenic
913158159 1:116120670-116120692 CCTACTATGTAGCAGGTGCCAGG - Intronic
914449338 1:147776894-147776916 TCTATTGTATAGAAGGAGGAGGG - Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
916220600 1:162440954-162440976 CCGACTCTGTAGCAGCAGGAGGG - Intergenic
916312510 1:163412614-163412636 CCAACTCTGGACAAGGAGGAAGG + Intergenic
919030836 1:192240062-192240084 AGTACTATGTAGAAAGAGCAGGG - Intergenic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
924469505 1:244328906-244328928 CCTATAATGGAAAAGGAGGAAGG - Intergenic
1063570825 10:7213278-7213300 CCTACTGTGTATTAGGAGGAAGG + Intronic
1065928563 10:30458219-30458241 CTTACTATGTACAGGTAGGAGGG - Exonic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1070160350 10:73863134-73863156 TCTACTTTGTGGAAGGAGGTGGG + Intronic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1073207847 10:101778123-101778145 CCTACTGTGTACAAGGATGAGGG - Intronic
1074078743 10:110151615-110151637 CCATCCATGTAGAAGGAAGAGGG - Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1077354402 11:2108595-2108617 CCTATTGTGGGGAAGGAGGAGGG - Intergenic
1077424094 11:2466362-2466384 CCTACTTTGCAGGAGGAGGGGGG + Intronic
1078067771 11:8089461-8089483 CCCACATGGTAGAAGGAGGAAGG - Intronic
1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG + Intergenic
1082283018 11:50290995-50291017 CATACTTTGTAGAGGGAGGTAGG + Intergenic
1085949067 11:81307558-81307580 ACAACTATGGAGAAAGAGGAAGG - Intergenic
1086260182 11:84930552-84930574 TCTACTAAGTGGAATGAGGATGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1088162699 11:106892616-106892638 CATTCTTTGTTGAAGGAGGAAGG - Intronic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089442499 11:118529013-118529035 CCTACTATGTGGCAGTAGGCTGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092947505 12:13470507-13470529 CCTACTATATGCCAGGAGGAGGG + Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1095054120 12:37580360-37580382 GCTACTATGTAGGCTGAGGAGGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1098196813 12:68010868-68010890 ACTCCTATGCAAAAGGAGGATGG + Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101208461 12:102512759-102512781 CCTTCTGTTTAGAAGGAGAAAGG - Intergenic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1102799826 12:115722427-115722449 CCTAATCTGTAGAAGAAGGTAGG - Intergenic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1105478402 13:20749306-20749328 TCTACATTGTAGTAGGAGGATGG - Intronic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1107315269 13:39124797-39124819 CCTACTAGTTAGAGGTAGGAAGG - Intergenic
1109456923 13:62605219-62605241 CCTACTGTGCTGAAGCAGGAAGG + Intergenic
1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG + Intergenic
1111695264 13:91615310-91615332 CATACTAGTTAGAAGAAGGAGGG + Intronic
1111994123 13:95146252-95146274 CCTACTTTATGGTAGGAGGAGGG + Intronic
1115882893 14:37939926-37939948 CCTACAATGTAAAATGAGAATGG + Intronic
1116516872 14:45815192-45815214 CCTAATATCTAGAAGGGGAAAGG + Intergenic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1120205936 14:81587820-81587842 CGAATTATGTAGAAGGAGGAGGG - Intergenic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG + Intergenic
1126865676 15:52934248-52934270 GCTACTGTGTCCAAGGAGGATGG + Intergenic
1127077655 15:55343715-55343737 CCTTCTAAGTAGACAGAGGATGG - Intronic
1130907632 15:88251675-88251697 CCAACTCTGTAGAAGGACCAGGG - Intronic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1133337527 16:5015654-5015676 CCCCCTAAGAAGAAGGAGGAAGG + Exonic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1138737436 16:59266625-59266647 CCTACTAAGTAGATGAAAGATGG + Intergenic
1138930844 16:61653989-61654011 GCTACGATGATGAAGGAGGAGGG - Exonic
1140236128 16:73160556-73160578 CCCTCTATGTAGATGGAGGGAGG - Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1140705849 16:77628448-77628470 CCTACCATGAAGAATGATGAAGG - Intergenic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG + Intergenic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1146469680 17:33114005-33114027 CCTACTATGTGCAAGGATTATGG + Intronic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1148535458 17:48434839-48434861 ATTACTATTTAGATGGAGGAGGG - Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1153265393 18:3263732-3263754 GCTAATGTGTAGAATGAGGAAGG - Intronic
1155866461 18:30972262-30972284 CCTAGTATGTTAAAGGAGGGTGG - Intergenic
1156499035 18:37545318-37545340 GCTACTAGGCAGCAGGAGGAAGG - Intronic
1157887865 18:51385660-51385682 TCTACTATTTAGAAGCAGGTGGG + Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1160303439 18:77707048-77707070 CTTACTATGCTGAAGGATGAAGG - Intergenic
1164436763 19:28237168-28237190 CCTACTCTGTAGATGCAGAAAGG + Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1165914507 19:39249375-39249397 GCTACTATGGAGAATGAGGTGGG - Intergenic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
925825988 2:7849084-7849106 ATTACTATGGAGAAGGATGAAGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
932352829 2:71045900-71045922 CCTACTATCCAGAGGGAGGGAGG - Intergenic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
936744399 2:115557333-115557355 CCTACCATATAGAAGCAAGAAGG + Intronic
937790768 2:125958670-125958692 TCTACCATGTAGAAGGTTGATGG + Intergenic
937970091 2:127542558-127542580 CATACTATGGATAAGGATGAAGG + Intronic
938044180 2:128101802-128101824 CCTTCTATGTGGAACTAGGAGGG - Intronic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
943132580 2:183872967-183872989 AAAATTATGTAGAAGGAGGAAGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
947225435 2:227835427-227835449 CATACCATATAGAAAGAGGAAGG - Intergenic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
1168740360 20:185026-185048 CCTACTTTGTAGAATGAGTTAGG - Intergenic
1169137672 20:3207370-3207392 CCTACTATGTACCAGGAGCTGGG + Intergenic
1169150973 20:3289098-3289120 GCTACTTTGTAGAATGAGGTGGG + Intronic
1169652206 20:7882041-7882063 CCTAGCATTTAGAAGGAGAAAGG + Intergenic
1172942213 20:38661923-38661945 CCTACTATGGGGGAGGGGGAGGG + Intergenic
1174420927 20:50398841-50398863 CCTACTATGTACCAGGAGTGGGG - Intergenic
1175162850 20:57021747-57021769 CCTACTAGGTAGATGGAGGGTGG + Intergenic
1178422620 21:32454368-32454390 GGTACTATGTAGTAGAAGGAAGG - Intronic
1184307661 22:43617534-43617556 CCAAGTATGTAAAATGAGGAAGG - Intronic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
950367336 3:12496894-12496916 CCTACAGTGTAGCTGGAGGAAGG - Intronic
953137359 3:40192882-40192904 GTTACTATGTAGAAGCATGATGG - Intronic
953364953 3:42336440-42336462 CTTTCTATATAGAAGGAGGCTGG + Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
957254016 3:77813423-77813445 ACTACTCTGCAGGAGGAGGAAGG + Intergenic
958868280 3:99526595-99526617 ACTACAAAGTAGAAGGAGGTGGG + Intergenic
960576309 3:119233246-119233268 CCCACTCTGTAGAATGAGGGAGG - Intronic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962883587 3:139601857-139601879 CCTACAATGTTGAAGGCAGATGG + Intronic
966086812 3:176078349-176078371 CCTACAATTTTGAAGGAGAAGGG - Intergenic
967632435 3:191760860-191760882 CTTACAATGTAGTAGGAAGAGGG + Intergenic
968322936 3:197787442-197787464 TCTACTGAGTAGAAGGGGGAAGG + Exonic
972324883 4:38006027-38006049 CCTGCTATGTAAAATGAGAAAGG - Intronic
972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG + Intergenic
973106459 4:46344694-46344716 ACTACTACACAGAAGGAGGAGGG + Intronic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
979418636 4:120475888-120475910 CCTTCTATATAGAAGGATGTTGG - Intergenic
987846542 5:23294748-23294770 CCTACTAGGTAGAAGGGGTTGGG - Intergenic
987928807 5:24376329-24376351 CATAGTATGTAAAAGAAGGAAGG + Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
990334867 5:54762698-54762720 CCAACTTTGGAGATGGAGGAAGG - Intergenic
990685833 5:58300084-58300106 CCTTCTATGTGGAAGGGGGTTGG - Intergenic
996484156 5:124011837-124011859 CCAACATTGTAGAGGGAGGATGG - Intergenic
999036035 5:148350826-148350848 ACTACTATGCAGAAGCAGTATGG - Intergenic
999146585 5:149399969-149399991 GCTACTGTGAAGAAGCAGGAAGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000371028 5:160536880-160536902 CCTACTCTGTAGAGAGAGCAGGG - Intergenic
1002668082 5:180841751-180841773 CATACTATGAAAAAGGAAGAAGG + Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1009049919 6:58263515-58263537 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009225464 6:61016774-61016796 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1010300142 6:74250994-74251016 CCTACTATCTAGCAGAAAGAGGG - Intergenic
1010982288 6:82381907-82381929 TATACTATCCAGAAGGAGGATGG - Intergenic
1011489456 6:87875421-87875443 CATTCTATGTGGGAGGAGGAAGG - Intergenic
1012023877 6:93962986-93963008 CATTCTATGTAGCAGGAGCAAGG + Intergenic
1015195116 6:130517164-130517186 CCTACTATGTATCAGGAACAGGG - Intergenic
1017099162 6:150832221-150832243 CTTACTTTGGAGAAGGAAGAAGG - Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1020816652 7:12913905-12913927 CCTCCTGTGTAGAACAAGGAAGG - Intergenic
1023609720 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG + Intergenic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1027613607 7:80393340-80393362 CCTACTTTGTATAATTAGGAAGG - Intronic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030535786 7:110765167-110765189 TCTACTATGTAAAAGCAGGTAGG + Intronic
1033595744 7:142856598-142856620 CACTCTAGGTAGAAGGAGGATGG + Intronic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1038635149 8:29280342-29280364 CCTACTAAGTAGGCTGAGGAGGG + Intergenic
1043526562 8:81104089-81104111 CCTACCATGTGGAAGGTGGGTGG - Intronic
1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG + Intronic
1047058294 8:121192862-121192884 ACTACTATGTAGAAGAGTGAAGG + Intergenic
1047473566 8:125203342-125203364 ACTAATATCTAGAAAGAGGAAGG + Intronic
1047566725 8:126051922-126051944 CCTTCTGTGTAGGAAGAGGAGGG + Intergenic
1048598716 8:135895549-135895571 CATTCCAAGTAGAAGGAGGAAGG - Intergenic
1050063931 9:1738850-1738872 CCTAATTTGGAGAAGGAGGAGGG - Intergenic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1052660564 9:31423880-31423902 CCGACTAAGTAGAAGTAGAATGG + Intergenic
1052723404 9:32200364-32200386 CCTACCATGTGGAAGGAAGCTGG + Intergenic
1055872002 9:80891840-80891862 CCTACTATGAACAAGGAGCATGG + Intergenic
1060666010 9:125432687-125432709 GCTACTATGTGGAGGCAGGAAGG + Intergenic
1186033141 X:5391669-5391691 CCTACTCTTTCGAGGGAGGAGGG + Intergenic
1190576675 X:51846364-51846386 CCTACTTTGAAGATGGAAGATGG + Intronic
1193998546 X:88397906-88397928 AATACTATGTAGAAGAAGGGAGG - Intergenic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1196692170 X:118571594-118571616 ACTAATATGTAGACCGAGGAGGG - Intronic
1196988269 X:121298883-121298905 CCTACTATGTATTTGGAAGAGGG + Intergenic
1197275910 X:124478772-124478794 TCTACTAAGTGGAAGGAAGAAGG + Intronic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1200961369 Y:8999063-8999085 CCTATTATGTAGGAGGAGAATGG + Intergenic