ID: 907393565

View in Genome Browser
Species Human (GRCh38)
Location 1:54174428-54174450
Sequence AGGAGGAGTGATTAACCTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907393553_907393565 15 Left 907393553 1:54174390-54174412 CCCCTACAGCCCATCCTCCTTCT 0: 1
1: 0
2: 4
3: 42
4: 487
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393551_907393565 26 Left 907393551 1:54174379-54174401 CCTCCTCAGGGCCCCTACAGCCC 0: 1
1: 0
2: 7
3: 43
4: 391
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393552_907393565 23 Left 907393552 1:54174382-54174404 CCTCAGGGCCCCTACAGCCCATC 0: 1
1: 0
2: 2
3: 34
4: 278
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393557_907393565 5 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393554_907393565 14 Left 907393554 1:54174391-54174413 CCCTACAGCCCATCCTCCTTCTA 0: 1
1: 0
2: 2
3: 25
4: 266
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393556_907393565 6 Left 907393556 1:54174399-54174421 CCCATCCTCCTTCTACATAGTAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393555_907393565 13 Left 907393555 1:54174392-54174414 CCTACAGCCCATCCTCCTTCTAC 0: 1
1: 0
2: 2
3: 35
4: 392
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393561_907393565 -2 Left 907393561 1:54174407-54174429 CCTTCTACATAGTAGGAGGCCAG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200
907393560_907393565 1 Left 907393560 1:54174404-54174426 CCTCCTTCTACATAGTAGGAGGC 0: 1
1: 0
2: 2
3: 6
4: 112
Right 907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG 0: 1
1: 0
2: 0
3: 12
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907393565 Original CRISPR AGGAGGAGTGATTAACCTCA TGG Exonic
903533067 1:24047000-24047022 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
903954810 1:27017965-27017987 AGCAGGAGGGATTTACCCCAGGG + Intergenic
905378560 1:37542849-37542871 AGGAGAACTGCTTAAGCTCAGGG + Intronic
905513790 1:38545704-38545726 AGGAGGAGTGATGTATCTGATGG - Intergenic
906323303 1:44829563-44829585 AGGAGGAGGGAATGGCCTCAGGG + Intronic
906642661 1:47450639-47450661 AGGAGGAGTTCACAACCTCAAGG + Intergenic
907176653 1:52530067-52530089 AGGAGGATTGCTTAAGCTCAGGG - Intronic
907393565 1:54174428-54174450 AGGAGGAGTGATTAACCTCATGG + Exonic
907649875 1:56285085-56285107 TGGAGGAGTGCTGAACATCAGGG - Intergenic
908167471 1:61472634-61472656 AGGAGGATTGCTTAAGCCCAGGG - Intergenic
908704994 1:66943644-66943666 AGGAGGACTGCTTGAGCTCAGGG - Intronic
910981795 1:92965469-92965491 TGGAGGAGTGATTAAACCTAGGG + Intergenic
911125961 1:94341069-94341091 ATGGGGAGTGTTTGACCTCAAGG + Intergenic
911697067 1:100901544-100901566 AGGAGGATTGCTTGAACTCAGGG - Intronic
912296853 1:108478060-108478082 AGTGGGAGTGATTAAGCTGAAGG - Intergenic
912939409 1:114031912-114031934 AGTAGGAGAGATTAAGCTGAAGG - Intergenic
916729668 1:167554537-167554559 AGGAGGAGATAATAACTTCAGGG - Intergenic
917224671 1:172768745-172768767 AGGAGGAGTAGTTAACCTGATGG + Intergenic
920901138 1:210111595-210111617 AGTAGGAGAGATTAAGCTGAAGG + Intronic
921939799 1:220827879-220827901 AGAAGAAGAGATCAACCTCAGGG - Intergenic
922298047 1:224269310-224269332 AGGAGGATTGGTTGAGCTCAGGG - Intronic
923109727 1:230880902-230880924 AGTAGGTACGATTAACCTCAGGG - Intergenic
924278967 1:242417221-242417243 AGGAGGTGGGACTAAACTCAGGG + Intronic
1063725882 10:8637177-8637199 GGGAGGAATTATTTACCTCAGGG - Intergenic
1064203661 10:13304737-13304759 AGGAGGATTGCTTGAGCTCAGGG + Intergenic
1064388837 10:14923574-14923596 AGGAGGATTGCTTAAGCCCAGGG + Intronic
1065707197 10:28481351-28481373 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
1066425600 10:35304849-35304871 AGGGGGAGTGCTGAGCCTCAAGG + Intronic
1066458012 10:35588261-35588283 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
1068101250 10:52556384-52556406 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
1069087491 10:64158353-64158375 AGGAGGCGTGATTTTTCTCATGG - Intergenic
1069616589 10:69810473-69810495 AGGGGCAGTGATGAAGCTCACGG + Intronic
1070448413 10:76531969-76531991 AGAAGAAGTGAATAACCTGAAGG - Intronic
1070597852 10:77845226-77845248 AGGTGGAGTGACTCACCCCAGGG - Intronic
1071852945 10:89593770-89593792 AGCAGTAGTGATTAAACACAAGG - Intronic
1072650753 10:97293198-97293220 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
1074331715 10:112518480-112518502 AGGAGGATTGCTTAAGCCCAAGG + Intronic
1075347946 10:121697990-121698012 AGGAGGATTGCTTGAGCTCAGGG + Intergenic
1077588208 11:3470805-3470827 AGTAGGAGAGATTAAGCTGAAGG + Intergenic
1078325387 11:10376375-10376397 AGAATGAGTGATTAACCCAAGGG + Intronic
1078343008 11:10514387-10514409 AGGAGCAATAATTAACCACAAGG + Exonic
1079564323 11:21863132-21863154 AGGAGGATGGCTTAAGCTCAGGG + Intergenic
1082160976 11:48887395-48887417 AGGAGGAATGATTGATTTCATGG - Intergenic
1082161390 11:48893011-48893033 AGGAGGAATGATTGATTTCATGG + Intergenic
1085499835 11:77009717-77009739 AGGAGGATTGATTGAGCCCAGGG + Intronic
1086007615 11:82057074-82057096 AGGAGTAGTGATTAAGACCAGGG - Intergenic
1090476791 11:127029818-127029840 AGGAGGGGGGATTAACTTTAAGG + Intergenic
1092912300 12:13157267-13157289 ACTAGCAGTGAATAACCTCATGG + Intergenic
1093746092 12:22742372-22742394 AGGGGGAGGGATTAGCCTTAAGG + Intergenic
1095748888 12:45689436-45689458 AGGAGGATTGCTTCAGCTCAAGG - Intergenic
1096125643 12:49117493-49117515 GGGAGGAGTGATTGAACCCAGGG + Intergenic
1098114598 12:67161647-67161669 AGGAGGATTGCTTAAGCCCAGGG + Intergenic
1098289115 12:68938308-68938330 AGGAGGATTGCTTGACCCCAGGG + Intronic
1098920395 12:76297199-76297221 AGTAGGAGAGATTAAGCTGAAGG - Intergenic
1099495670 12:83343214-83343236 AGGAGGACTGAATAATTTCATGG + Intergenic
1100974861 12:100111966-100111988 AGGAGGATTGCTTGACCCCAGGG - Intronic
1101277162 12:103215476-103215498 AGAAGGAATGAGTAACCTAATGG + Intergenic
1101977131 12:109369435-109369457 AGGAAGAGTGGTAAACCTCTGGG + Intronic
1102660740 12:114525894-114525916 AGGAGGAGAGAGAAACATCAGGG - Intergenic
1103436915 12:120933851-120933873 AGGAGGATTGCTTGACCCCAGGG - Intergenic
1104723031 12:131056753-131056775 AGGGGAAGTGATTATCCCCACGG - Intronic
1107339458 13:39390404-39390426 AGGAGGATTGCTTAAGCACAGGG + Intronic
1110709031 13:78629642-78629664 AGGAGTAGTAATTAAAGTCAAGG + Intronic
1115362908 14:32523765-32523787 AGGAGGAGTATTTAACTTCATGG - Intronic
1118358555 14:65036461-65036483 AGGCGGATTGCTTAAGCTCAGGG - Intronic
1118373693 14:65158698-65158720 AGGAGGACTGACTGAGCTCAGGG + Intergenic
1119835361 14:77744804-77744826 AAGAAGAGTGATTACCCCCAAGG + Intronic
1120780860 14:88484137-88484159 AGGAGGATTGCTTAAGCCCAAGG - Intronic
1121197992 14:92091920-92091942 AGGAGGATTGCTTGAGCTCAAGG - Intronic
1125849837 15:42892478-42892500 AGGTGGATTGATTGAGCTCAGGG + Intronic
1126558033 15:50011718-50011740 AGAAGGAATGATTAGCATCATGG - Intronic
1126945374 15:53813334-53813356 AGGAGGATTGCTTGAACTCAGGG + Intergenic
1128334513 15:66777555-66777577 AGGAGGATTGCTTGAGCTCAAGG + Intronic
1128483829 15:68065361-68065383 AGGCAGAGTGCTTAAGCTCAGGG + Intronic
1129763003 15:78142520-78142542 AGGAGGAGGGAGACACCTCATGG - Intronic
1132895458 16:2227129-2227151 AGGAGGATTGATTGAGCCCAGGG - Intronic
1133799940 16:9076917-9076939 AGGAGGATTGCTTGACCCCAGGG + Intergenic
1133877224 16:9746346-9746368 AGGAGTAGTGCTTAAGCCCAGGG + Intergenic
1134084456 16:11346814-11346836 AGGAGGATTGCTTGAGCTCAGGG - Intronic
1135058071 16:19247264-19247286 AGAAAAAGTGATTAACCTCAAGG - Intronic
1136091407 16:27922877-27922899 AGGAGGATTGTTTAAGCCCAGGG - Intronic
1137735608 16:50720724-50720746 AGGAAGAGAGAATAACCTTAGGG + Intronic
1138665820 16:58567394-58567416 AGGAGGAGTGCCTCAGCTCAGGG + Intronic
1139044039 16:63034633-63034655 AGGAGAAGTGTTTACCCACATGG - Intergenic
1139689553 16:68631560-68631582 AGGAGGACTGATTGAGCCCAGGG + Intergenic
1140762739 16:78125633-78125655 AGGAGGATTGCTTGAGCTCAGGG + Intronic
1140857616 16:78991707-78991729 ACGAGGAGGGGTTAACCTTATGG - Intronic
1141536475 16:84684559-84684581 AGGAGGAGTGCCTAACTCCACGG - Intergenic
1143149552 17:4799094-4799116 AGGGGGTGTGATCAACCTCTTGG + Intergenic
1143850490 17:9807963-9807985 GGGAGGATTGCTTAAGCTCAGGG + Intronic
1146589152 17:34113332-34113354 AGGAGGATTGCTTGAGCTCAAGG + Intronic
1147169656 17:38610543-38610565 AGGAGGGGAGAATAACCGCAAGG + Intergenic
1148383048 17:47213898-47213920 AGGAGGAGTAGTTGTCCTCATGG + Intronic
1149079808 17:52641705-52641727 TGGAGGTGTGATTAGCTTCATGG + Intergenic
1150299421 17:64036180-64036202 AGGAGGATTGCTTAAGCCCAGGG + Intergenic
1150886033 17:69086946-69086968 AAGAGGGGTGGCTAACCTCATGG + Intronic
1151366502 17:73620105-73620127 AGGAGGATTGCTTAAGCCCAGGG + Intronic
1155183333 18:23367055-23367077 AGGAGAAGTGATCACTCTCATGG + Intronic
1155903639 18:31422982-31423004 AGCTGGAGTGATTACCCTAAGGG + Intergenic
1156072982 18:33236465-33236487 AGCAGGAGTGATTAACCATTGGG + Intronic
1157781880 18:50446742-50446764 AGGATGATTGATTTACCACAGGG - Intergenic
1159164890 18:64686749-64686771 AGTGGGAGTGATTAAACTGAAGG - Intergenic
1159280741 18:66281326-66281348 AGGAAGACTGGTCAACCTCAAGG - Intergenic
1162356985 19:10192192-10192214 AGGAGGATTGCTTGAGCTCAGGG + Intronic
1163401800 19:17098402-17098424 AGCAGGAGTGATTATCCTAAAGG - Intronic
1165342458 19:35222748-35222770 AGGAGCAGTCCTTAACCTCGAGG - Intergenic
1167297389 19:48659628-48659650 AGGAGGATTGCTTGAGCTCAGGG + Intergenic
1168701958 19:58445721-58445743 AGGAGAATTGCTTGACCTCAGGG + Intergenic
930029310 2:47048692-47048714 AGGAGGATTGCTTAAGCCCAGGG - Intronic
930695029 2:54402576-54402598 AGGAGGAGTGATTTCTCTGATGG - Intergenic
931665043 2:64604455-64604477 AGTAGGAGTGATGACCCACAGGG - Intergenic
931800962 2:65757116-65757138 AGGAGGACTGATTGATTTCATGG - Intergenic
935055882 2:99566316-99566338 AGGAGAGGAGATAAACCTCAAGG + Intronic
937600847 2:123730011-123730033 GGGAGGATTGCTTGACCTCAGGG - Intergenic
939291143 2:140196388-140196410 AGAATGAGTTATTAAACTCAAGG - Intergenic
939724781 2:145703566-145703588 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
942117952 2:172747687-172747709 AGGAGGATTGCTTAAGCCCAGGG - Intronic
944962106 2:204886859-204886881 AGGTGGTGTGTTTAACATCAGGG + Intronic
945580497 2:211588729-211588751 GTGCGGAGTGATTAACATCATGG - Intronic
947965595 2:234278767-234278789 AGGGGGAGTGATTTACATCAGGG - Intergenic
1169062068 20:2668009-2668031 AGGAGAAGTGATTACACTCAGGG + Intergenic
1169905241 20:10596312-10596334 AGGAGGATTGCTTGAGCTCAGGG - Intronic
1170725732 20:18924566-18924588 AGGAGGATTGCTTGACCCCAGGG - Intergenic
1172469287 20:35179313-35179335 AGGAGGATTGCTTGAGCTCAGGG + Intergenic
1172502212 20:35435357-35435379 GGGAGGATTGATTGACCCCAGGG + Exonic
1173538881 20:43836828-43836850 AGGAGGATTGCTTAAGGTCAAGG - Intergenic
1173763378 20:45584805-45584827 AGTAGGAGAGATTAAGCTGAAGG + Intergenic
1173782105 20:45764661-45764683 AGTAGGAGAGATTAAGCTGAAGG - Intronic
1175035754 20:55999534-55999556 AGGAGGATTGCTTGAACTCAGGG + Intronic
1175531825 20:59678805-59678827 AGGAGGAGTGCCTACCCTCCAGG - Intronic
1175995299 20:62809634-62809656 TGTAGGAGTGATTGTCCTCAAGG - Exonic
1178325633 21:31643113-31643135 AGGAGTATTGCTTAAGCTCAGGG + Intergenic
1179841474 21:44078142-44078164 AAGAGGACTGAAAAACCTCAAGG + Intronic
1180647712 22:17353237-17353259 AGGAGGATTGATTGAGCCCAGGG - Intergenic
1183505119 22:38204428-38204450 AGGAGCTGTGATTCACTTCAGGG + Intronic
949979522 3:9493071-9493093 AGGAGGAGTTTTTAATCTGAGGG - Intergenic
952130953 3:30362408-30362430 GGGAGAAGTGATTAATTTCAGGG + Intergenic
952326846 3:32327982-32328004 AGGAGGACTGCTTGAGCTCAGGG + Intronic
952342339 3:32456822-32456844 AGGAGGAGTGAGTCACCATAGGG - Intronic
954017141 3:47703295-47703317 AGGAGGACTGCTTGACCTCAGGG + Intronic
954486077 3:50852395-50852417 AGGAGTAGATATTAACTTCAAGG + Intronic
956200859 3:66704461-66704483 AGGAGGATTGCTTAAACCCAGGG - Intergenic
956548553 3:70435234-70435256 AGGGGGAGAGATTAAGCTGAAGG + Intergenic
957351464 3:79027652-79027674 GAGAGGAGTGATTAAACTCTTGG - Intronic
957734451 3:84188337-84188359 AGTGGGAGAGATTAACCTGAAGG + Intergenic
958476493 3:94590678-94590700 AAGAAGAGAGATTAACTTCAGGG - Intergenic
961183120 3:124891695-124891717 AGGAGGATTGCTTGAGCTCAGGG + Intronic
961689034 3:128654954-128654976 AGGAGGATTGCTTGACCCCAAGG + Intronic
962112049 3:132461917-132461939 AGGAGGATCGCTTAAGCTCAGGG - Intronic
965916297 3:173850969-173850991 AGGAGGATTGCTTGAGCTCAGGG - Intronic
966398055 3:179521908-179521930 AGTAGGAGAGATTAAGCTGAAGG - Intergenic
967731725 3:192913167-192913189 AGGAGGATTGCTTGAACTCAGGG + Intronic
968167830 3:196482031-196482053 AGGAGGATTGCTTAAGCCCAGGG - Intronic
971364314 4:25965290-25965312 AGGAGGAATGACCAACCTCTTGG - Intergenic
972097326 4:35364477-35364499 AGGAGGATTTATTATCCTCCTGG + Intergenic
974592067 4:63964465-63964487 AGGATGAATGCTTAACCTAAAGG + Intergenic
974620822 4:64351365-64351387 AGGAGGATTGCTTGAGCTCAAGG - Intronic
977767527 4:100817425-100817447 AGGAGGAGAGATGAAGCCCAGGG - Intronic
978334713 4:107654084-107654106 AGGAGGAGCTATTACCCTCCAGG + Intronic
981095553 4:140775822-140775844 AGGAGGAGTCATTGGTCTCATGG + Intergenic
988998202 5:36734606-36734628 AACAGGAGTGACTAACCTCTGGG + Intergenic
992426799 5:76666080-76666102 AAGAGGCGTGGCTAACCTCATGG + Intronic
995856061 5:116593567-116593589 AGCGGGAGTGATTAACCAAATGG - Intergenic
996129375 5:119762930-119762952 AGGAGGATTGATCAAACTAAAGG + Intergenic
996742287 5:126811699-126811721 AGGAAGCATGATTCACCTCAAGG - Intronic
996803963 5:127433902-127433924 AGGATGAATGATTTGCCTCAAGG - Intronic
999373938 5:151073254-151073276 AGGAGGTGTGAGTTACCTAAGGG + Intronic
999715585 5:154357471-154357493 AGGAGGAGTAATTCACCAAATGG - Intronic
1004789336 6:19006715-19006737 AGGAGGATTGCTTAAGCCCAGGG + Intergenic
1004997430 6:21207299-21207321 AGGAGGAGTGCTTGACCCCAAGG + Intronic
1005608490 6:27500068-27500090 AGGAGGAGTGCTTGAGCCCAGGG + Intergenic
1006629012 6:35418025-35418047 AGGAGGTGTGAATAATCTGAGGG + Intronic
1010751875 6:79624943-79624965 AGGAGGACTGCTTAAGCCCAGGG + Intergenic
1012761944 6:103313898-103313920 AGGAGGATTGATTGAGCCCAGGG + Intergenic
1013222858 6:108094975-108094997 AGGAGGATTGCTTGAGCTCAGGG - Intronic
1015017653 6:128433741-128433763 AGGAGGATTGTTTGAGCTCAGGG - Intronic
1016210067 6:141521159-141521181 AGGAGGATTGCTTAAACCCAGGG - Intergenic
1016607202 6:145943920-145943942 ATCAGGAGTGATTCTCCTCAGGG - Intronic
1020504924 7:8973813-8973835 AGGAGGATTGCTTAATCTCAGGG - Intergenic
1026132597 7:67632789-67632811 AGGAGGATTGCTTAAGTTCAGGG - Intergenic
1026999407 7:74641715-74641737 AGGAGGAGTGCTTGAGCCCAGGG + Intergenic
1029870761 7:103690363-103690385 TGGGGGAATGATTAATCTCAAGG - Intronic
1030205486 7:106948707-106948729 CTGAGGAGTAATTAAACTCAAGG - Intergenic
1033133537 7:138765976-138765998 AGGAGGATTGCTTGAGCTCAGGG - Intronic
1033386427 7:140880876-140880898 AGGAGGATTGCTTGAGCTCAGGG + Intronic
1033636909 7:143220241-143220263 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
1033679623 7:143581316-143581338 AGGAGGATTGTTTGAGCTCAAGG - Intergenic
1033692213 7:143748127-143748149 AGGAGGATTGTTTGAGCTCAAGG + Intergenic
1036035787 8:5017663-5017685 AGGAAGAGTGAATGACCACAGGG + Intergenic
1036785992 8:11687415-11687437 AGGAGGATTGCTTGACCTCCCGG - Intronic
1038346465 8:26736787-26736809 AGGAGGATTGCTTCAGCTCAGGG - Intergenic
1043382900 8:79722261-79722283 AGGTGGAATGCTTAAGCTCAGGG + Intergenic
1045309773 8:100991014-100991036 AGGAGGATTGCTTGAGCTCAGGG - Intergenic
1047679204 8:127236769-127236791 AGGTGGAGTTATGAAGCTCAAGG - Intergenic
1053031381 9:34782081-34782103 AGGAGGAATGATGAAACTGAGGG + Intergenic
1057163837 9:92910863-92910885 AGGAGGATTGTTTAAGGTCAGGG + Intergenic
1057216764 9:93232898-93232920 AGGAGAATTGCTTAAGCTCAGGG + Intronic
1060198728 9:121639675-121639697 GGGAGGGGTTATAAACCTCATGG - Intronic
1061426824 9:130504456-130504478 AGGAGGATTGCTTAAGCCCAGGG + Intergenic
1061718895 9:132539381-132539403 AGGAGGAGAGACTGACCTCAGGG - Intronic
1062714809 9:138003749-138003771 AGGAGAAATGATCAAACTCACGG + Intronic
1186343340 X:8665973-8665995 AGGAGGATTGCTTGACCCCAGGG + Intronic
1186400427 X:9253649-9253671 AGGAGGACTGCTTGACCCCAAGG + Intergenic
1188859314 X:35238081-35238103 AGGAGAATTGCTTAAACTCAGGG + Intergenic
1192005464 X:67207312-67207334 AGGAAGTATGATGAACCTCATGG - Intergenic
1192579019 X:72265436-72265458 AGCAGGTGTGAATAACTTCAAGG - Intronic
1192589177 X:72345771-72345793 GGGAGGATTGCTTAACCCCAGGG - Intronic
1193094850 X:77536139-77536161 AGGAGGATTGTTTGAGCTCAGGG - Intronic
1193536124 X:82717423-82717445 AGAAGGACTGATTAAGCTCATGG - Intergenic
1194820830 X:98505050-98505072 AGGAGGATTGCTTGAACTCAGGG - Intergenic
1195353812 X:104019406-104019428 AGGAGAACTGATAAACCTTAAGG - Intergenic
1196889202 X:120276020-120276042 AGGAGGATTGACTAAGCCCAGGG - Intronic
1202062811 Y:20905191-20905213 AGTGGGAGAGATTAACCTGAAGG - Intergenic