ID: 907393566

View in Genome Browser
Species Human (GRCh38)
Location 1:54174429-54174451
Sequence GGAGGAGTGATTAACCTCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 94}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907393556_907393566 7 Left 907393556 1:54174399-54174421 CCCATCCTCCTTCTACATAGTAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393555_907393566 14 Left 907393555 1:54174392-54174414 CCTACAGCCCATCCTCCTTCTAC 0: 1
1: 0
2: 2
3: 35
4: 392
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393561_907393566 -1 Left 907393561 1:54174407-54174429 CCTTCTACATAGTAGGAGGCCAG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393560_907393566 2 Left 907393560 1:54174404-54174426 CCTCCTTCTACATAGTAGGAGGC 0: 1
1: 0
2: 2
3: 6
4: 112
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393557_907393566 6 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393552_907393566 24 Left 907393552 1:54174382-54174404 CCTCAGGGCCCCTACAGCCCATC 0: 1
1: 0
2: 2
3: 34
4: 278
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393553_907393566 16 Left 907393553 1:54174390-54174412 CCCCTACAGCCCATCCTCCTTCT 0: 1
1: 0
2: 4
3: 42
4: 487
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393551_907393566 27 Left 907393551 1:54174379-54174401 CCTCCTCAGGGCCCCTACAGCCC 0: 1
1: 0
2: 7
3: 43
4: 391
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94
907393554_907393566 15 Left 907393554 1:54174391-54174413 CCCTACAGCCCATCCTCCTTCTA 0: 1
1: 0
2: 2
3: 25
4: 266
Right 907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG 0: 1
1: 0
2: 2
3: 13
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907393566 Original CRISPR GGAGGAGTGATTAACCTCAT GGG Exonic
905513789 1:38545703-38545725 GGAGGAGTGATGTATCTGATGGG - Intergenic
907393566 1:54174429-54174451 GGAGGAGTGATTAACCTCATGGG + Exonic
910089764 1:83448583-83448605 GTAGGAGAGCTTAATCTCATAGG - Intergenic
913338503 1:117733297-117733319 GGAGGGGCTATTAACCCCATAGG - Intergenic
914935441 1:151975116-151975138 GCAGGAGGGATTAACCTTAGAGG + Intergenic
917224672 1:172768746-172768768 GGAGGAGTAGTTAACCTGATGGG + Intergenic
920395840 1:205645336-205645358 GCAGGAGTGATTAACTTCAGAGG + Intergenic
921260058 1:213378348-213378370 GGAGGATTAATTCAACTCATTGG + Intergenic
921600016 1:217096691-217096713 AAAGGAGAGATTAACCTCAGTGG - Intronic
923425742 1:233867407-233867429 AGAAGAGTGATTAGCCACATAGG - Intergenic
1063230945 10:4065153-4065175 GGAGCAGTGATTTCACTCATGGG - Intergenic
1064895210 10:20227965-20227987 GGATGTGTGATTTACGTCATAGG + Intronic
1066670865 10:37837445-37837467 GGAGGAGTGATTAAGGTAACAGG + Intronic
1068468263 10:57425036-57425058 GGAGTAGAGATTGACCTCAAAGG + Intergenic
1073764168 10:106663886-106663908 GGAGGAGTGAATACCCAAATAGG - Intronic
1074312305 10:112332717-112332739 GGCAGAGTAATTAACCTCAAAGG + Intergenic
1075330901 10:121573422-121573444 GGAGGAGGGAGAAACCTCAGTGG - Intronic
1076645100 10:131948114-131948136 GGGGAAGTGATTCACCTCACTGG + Intronic
1080588096 11:33699551-33699573 GGAGGAGTCATTCAGCTCGTAGG + Intronic
1080837543 11:35953745-35953767 GGAAGAGTGATTAGCAACATAGG + Intronic
1082705576 11:56490840-56490862 GTAGAAGTGATTAATTTCATTGG + Exonic
1082912600 11:58393710-58393732 GGAGAAGCGATTGCCCTCATAGG - Intergenic
1084625608 11:70304130-70304152 GCATGACTGATTAACATCATTGG - Intronic
1085263648 11:75223763-75223785 TGAGGAGCTAGTAACCTCATAGG + Intergenic
1086164021 11:83756601-83756623 GAAGGAGATAATAACCTCATAGG + Intronic
1095761858 12:45848193-45848215 GGAGGCCTGATTACCCTGATAGG - Intronic
1096125644 12:49117494-49117516 GGAGGAGTGATTGAACCCAGGGG + Intergenic
1098431153 12:70421414-70421436 GCTGGAGTGCTTAACCTCCTGGG - Intronic
1101049861 12:100850342-100850364 GGAGGAATGACTCTCCTCATTGG - Intronic
1101711940 12:107275785-107275807 GGAGGAGTGATTTATCTGCTTGG - Intergenic
1107061158 13:36161147-36161169 GGAGGAGTGTTTAATCATATGGG + Intergenic
1108789163 13:53945785-53945807 GGAGTAGTGATTGACAACATTGG + Intergenic
1111478021 13:88779843-88779865 GGACAAGTGATTAATCTCCTGGG - Intergenic
1112537184 13:100270916-100270938 GGAGGATTGCTTAACCCCAGAGG + Intronic
1117768321 14:59106896-59106918 GGAGCAGTGAATAAGGTCATTGG + Intergenic
1121380719 14:93463528-93463550 GGAGGAGAGATTAATTTCATAGG + Intronic
1127144757 15:56012853-56012875 GGAGGAGTGGTTGAGCTCAGAGG + Intergenic
1129697212 15:77747430-77747452 GGGGGAGTGATTGACCTGCTTGG - Intronic
1129763002 15:78142519-78142541 GGAGGAGGGAGACACCTCATGGG - Intronic
1131845362 15:96485237-96485259 GGAGGTGTTATTAACCTCATCGG + Intergenic
1140482797 16:75271527-75271549 GGAGGATTGCTTGAGCTCATCGG - Intergenic
1142930246 17:3278375-3278397 GTAGAAGTGATTGACCTCATTGG + Exonic
1142945261 17:3421106-3421128 GTAGAAGTGATTGACCTCATTGG - Exonic
1143850491 17:9807964-9807986 GGAGGATTGCTTAAGCTCAGGGG + Intronic
1144079520 17:11749901-11749923 TGAGGAGGGACTTACCTCATTGG - Intronic
1147951163 17:44108882-44108904 GGAGGCGTGAGTCACCTCAGCGG - Intronic
1149079809 17:52641706-52641728 GGAGGTGTGATTAGCTTCATGGG + Intergenic
1149364914 17:55933758-55933780 GGAGGAGAGATGAAGATCATTGG + Intergenic
1151829215 17:76539951-76539973 TGAGGACTGATTAAGCTCACTGG - Intronic
1155367101 18:25059477-25059499 GGAGCAGTCATTCCCCTCATTGG - Intergenic
1162180073 19:8862702-8862724 GGAGTGAGGATTAACCTCATGGG - Intronic
1164882882 19:31750115-31750137 GAATGAGTGATTAACTTCTTAGG - Intergenic
930695028 2:54402575-54402597 GGAGGAGTGATTTCTCTGATGGG - Intergenic
931800961 2:65757115-65757137 GGAGGACTGATTGATTTCATGGG - Intergenic
932682685 2:73839752-73839774 TGAGGTGTGATTAAGCTCATAGG + Intronic
932832807 2:75007285-75007307 GGAGGATAGATTTACTTCATTGG - Intergenic
937600846 2:123730010-123730032 GGAGGATTGCTTGACCTCAGGGG - Intergenic
1169574573 20:6943754-6943776 GGCTGAGTGTTTAACCTCAATGG - Intergenic
1170199297 20:13725217-13725239 GGATGAGGGATTTACCTGATTGG - Intronic
1170536080 20:17342407-17342429 GGAGGATTGGTTGACCTCAGTGG - Intronic
1175606923 20:60318635-60318657 GGAGGAGTGACTATTCTCACCGG - Intergenic
1176136762 20:63526236-63526258 AGAATAGTGATTAACCACATAGG - Intergenic
1176864733 21:14040342-14040364 AGAGGAGTCATAAGCCTCATAGG - Intergenic
1181596519 22:23918496-23918518 AGAGGAGTCATTAACATCACAGG + Intergenic
1183603967 22:38858009-38858031 TGGGGAATGATTAACCCCATTGG - Intergenic
1184794606 22:46724618-46724640 GGTGGAGCGATGAACCCCATAGG + Intronic
952938148 3:38417375-38417397 ATAGCAGTGATTAAACTCATTGG + Intronic
954353214 3:50062982-50063004 GGAGGACTGCTTAAGCCCATGGG - Intronic
954844093 3:53539838-53539860 GGAGAAGTGTTTAACCTCACTGG - Intronic
957351463 3:79027651-79027673 AGAGGAGTGATTAAACTCTTGGG - Intronic
959915502 3:111812523-111812545 GGAGGAATTAATGACCTCATTGG + Intronic
960121266 3:113950448-113950470 GAAGGGGTGAATAAGCTCATAGG + Intronic
961493074 3:127268906-127268928 TGAGGAGTCATCATCCTCATTGG + Intergenic
963231667 3:142914639-142914661 GGAACAGTGATTAACCTGTTTGG + Intergenic
963302700 3:143616724-143616746 GGAGGAGTTGTTAGCCTCCTAGG - Intronic
966331664 3:178821557-178821579 AGAGGAGTGACTAATCTCAATGG - Intronic
972097327 4:35364478-35364500 GGAGGATTTATTATCCTCCTGGG + Intergenic
979814810 4:125087464-125087486 GGAGGTGTTAGTAACCTCAATGG + Intergenic
981845499 4:149163287-149163309 AGAGGAGTTACTAAACTCATTGG + Intergenic
982358140 4:154491254-154491276 GGAGGAGAGATACACCCCATGGG - Intronic
983204677 4:164900644-164900666 GTGGGAGTGACTAAGCTCATAGG + Intergenic
984842639 4:184082297-184082319 GGAGAAGTGATTTACCTTATTGG + Intergenic
995856060 5:116593566-116593588 GCGGGAGTGATTAACCAAATGGG - Intergenic
999086462 5:148895870-148895892 GTAGGAGTGTTTCACCTCCTTGG - Intergenic
1001121917 5:168987866-168987888 GGGGGACTGAATATCCTCATAGG + Intronic
1003947528 6:11089228-11089250 GGAGGAGTGATTTACTTAATTGG - Intergenic
1005091321 6:22059858-22059880 GAAGGAGTGATTAAGCTCTCTGG - Intergenic
1011288240 6:85747854-85747876 GGAATAGTGATTCACCACATAGG + Intergenic
1017932629 6:158971979-158972001 GGAAGAGTGGTGAATCTCATTGG + Intergenic
1020504648 7:8968858-8968880 AGAGGAGTGATTAAAAGCATGGG - Intergenic
1020504923 7:8973812-8973834 GGAGGATTGCTTAATCTCAGGGG - Intergenic
1021910390 7:25380093-25380115 GGAAGAGTGATTTTCCCCATGGG + Intergenic
1022302620 7:29115348-29115370 GGAGGAGGGATAGACCTCATTGG - Intronic
1023620066 7:42062010-42062032 GGAGGAGAGATTCATCTGATTGG + Intronic
1023759315 7:43449080-43449102 GGAGGAGTAATTAACCTGATTGG + Intronic
1024125434 7:46290177-46290199 GGAGCAGTGATTTAGGTCATAGG + Intergenic
1026383217 7:69820020-69820042 GCAGCAGCAATTAACCTCATAGG - Intronic
1027306622 7:76905030-76905052 GTAGGAGAGCTTAATCTCATAGG - Intergenic
1028736440 7:94218559-94218581 GGAGGAGTGATTGTCATGATGGG + Intergenic
1036662310 8:10716226-10716248 GGAGAAGTGATTTTCCTCCTGGG + Intergenic
1040845150 8:51830044-51830066 GAGGGAGTGATGAACCTAATGGG - Intronic
1047967611 8:130057976-130057998 GGAGAAGTGATTATCGTCACAGG - Exonic
1049266646 8:141671212-141671234 GGAGGAGTTATTGACCTGGTTGG + Intergenic
1051046960 9:12887180-12887202 GGAGGAGTGATGATACTTATAGG - Intergenic
1056301072 9:85242598-85242620 GGAGGAGTAAATAGCCTGATTGG + Intergenic
1057915168 9:99049735-99049757 GGAGCTGTGATTAACATCAAAGG + Exonic
1193536123 X:82717422-82717444 GAAGGACTGATTAAGCTCATGGG - Intergenic
1196207601 X:112958445-112958467 GGAGGAATGGCTAATCTCATTGG - Intergenic
1198571191 X:137959134-137959156 GGAGAAGGGATTTACCTAATTGG + Intergenic
1199126727 X:144131108-144131130 GCAGGAGTGATTCATCTGATTGG + Intergenic