ID: 907393567

View in Genome Browser
Species Human (GRCh38)
Location 1:54174430-54174452
Sequence GAGGAGTGATTAACCTCATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907393557_907393567 7 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393554_907393567 16 Left 907393554 1:54174391-54174413 CCCTACAGCCCATCCTCCTTCTA 0: 1
1: 0
2: 2
3: 25
4: 266
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393561_907393567 0 Left 907393561 1:54174407-54174429 CCTTCTACATAGTAGGAGGCCAG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393551_907393567 28 Left 907393551 1:54174379-54174401 CCTCCTCAGGGCCCCTACAGCCC 0: 1
1: 0
2: 7
3: 43
4: 391
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393555_907393567 15 Left 907393555 1:54174392-54174414 CCTACAGCCCATCCTCCTTCTAC 0: 1
1: 0
2: 2
3: 35
4: 392
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393560_907393567 3 Left 907393560 1:54174404-54174426 CCTCCTTCTACATAGTAGGAGGC 0: 1
1: 0
2: 2
3: 6
4: 112
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393552_907393567 25 Left 907393552 1:54174382-54174404 CCTCAGGGCCCCTACAGCCCATC 0: 1
1: 0
2: 2
3: 34
4: 278
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393556_907393567 8 Left 907393556 1:54174399-54174421 CCCATCCTCCTTCTACATAGTAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174
907393553_907393567 17 Left 907393553 1:54174390-54174412 CCCCTACAGCCCATCCTCCTTCT 0: 1
1: 0
2: 4
3: 42
4: 487
Right 907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907393567 Original CRISPR GAGGAGTGATTAACCTCATG GGG Exonic
903587546 1:24427631-24427653 GAGGAGTAATTATCATCAAGAGG + Intronic
904122883 1:28213924-28213946 GAGGATTGCTTAAACTCAGGAGG + Intronic
904518719 1:31077452-31077474 GAGGATTGATTGAGCTCAGGAGG - Intergenic
905728762 1:40279049-40279071 GAGGATTGATTGAGCTCAGGAGG + Intronic
907393567 1:54174430-54174452 GAGGAGTGATTAACCTCATGGGG + Exonic
907758938 1:57338669-57338691 GAAGAGTTATGAACTTCATGGGG - Intronic
907896620 1:58698825-58698847 GAGGGGTGATTAAACTCATATGG - Intronic
915892661 1:159785680-159785702 GAGCAGTGATGAGCCTCCTGTGG - Intergenic
917793753 1:178517017-178517039 GAGCAGTGATTGACAACATGTGG + Intronic
918217152 1:182401898-182401920 GAGGATTGATTGAGCTCAGGAGG - Intergenic
918814043 1:189159730-189159752 GAAGAGTGAACAACCACATGTGG - Intergenic
921600015 1:217096690-217096712 AAGGAGAGATTAACCTCAGTGGG - Intronic
922676223 1:227552591-227552613 GAGGAGTGTTTTACTTCATGTGG - Intergenic
1063230944 10:4065152-4065174 GAGCAGTGATTTCACTCATGGGG - Intergenic
1064673741 10:17741268-17741290 GAGGATTGATTAAGCCCAGGAGG - Intergenic
1065012427 10:21431679-21431701 GAGGATTGCTTGAGCTCATGAGG - Intergenic
1065305512 10:24364886-24364908 GAGGACTGCTTGACCTCAGGAGG - Intronic
1069571339 10:69496056-69496078 GAGGTGTGAGCAACCTCAAGGGG + Intronic
1070020071 10:72576251-72576273 TAGGAATGATTAAGCTTATGAGG + Intronic
1070238367 10:74654450-74654472 TAGGTGGGATTCACCTCATGAGG - Intronic
1070316578 10:75319047-75319069 GAGGATTGATTGACCTCAGGAGG - Intergenic
1072277697 10:93838977-93838999 GAGGACTGATTAAGCCCAGGAGG + Intergenic
1072993240 10:100218556-100218578 AAGTAGTCAATAACCTCATGTGG + Intronic
1080972658 11:37297523-37297545 GTGGAGTGACTAAGGTCATGTGG + Intergenic
1080997625 11:37623205-37623227 GAGGAGTCATAAAAATCATGGGG + Intergenic
1081619992 11:44613731-44613753 GAGGATTGCTTAACCCCAGGAGG + Intronic
1093260922 12:16936948-16936970 GAGGATTGCTTAAACTCAGGAGG - Intergenic
1093338328 12:17937653-17937675 GAGCATAGATTACCCTCATGTGG - Intergenic
1095535169 12:43237585-43237607 GTGGAGTGATTAACCTGGGGTGG - Intergenic
1095735378 12:45550479-45550501 GAGGTGTGATTAAACAAATGAGG - Intergenic
1095789485 12:46148609-46148631 GAGGAATGAAAAACTTCATGAGG - Intergenic
1096125645 12:49117495-49117517 GAGGAGTGATTGAACCCAGGGGG + Intergenic
1096706885 12:53427759-53427781 TAGGAATGATTATCCACATGGGG + Intronic
1097482033 12:60140379-60140401 GGGGAGTTATGTACCTCATGGGG + Intergenic
1098417490 12:70252274-70252296 GAGGATTGATTAAGCCCAGGAGG - Intronic
1101107971 12:101458549-101458571 GAGGATTGCTTAAACTCAGGAGG - Intergenic
1103462631 12:121117239-121117261 GAGGCCTGACCAACCTCATGTGG - Intergenic
1103521540 12:121539241-121539263 GAGGACTGCTTCACCTCACGAGG + Intronic
1105238716 13:18589521-18589543 GATGAGTGATTCAACTCATCAGG - Intergenic
1106008338 13:25792832-25792854 GAAGACTGATTAAGCTCATGAGG + Intronic
1109321119 13:60811148-60811170 GATGAGTTATTGACCTCATTTGG + Intergenic
1110072402 13:71193526-71193548 GAGGTGTGATTAACATCAAAAGG + Intergenic
1110164148 13:72417699-72417721 GAAGAGTGATTAGTCTCATTTGG - Intergenic
1111297235 13:86296269-86296291 GAAGAGTGAATAATCTCAAGAGG + Intergenic
1116336910 14:43667803-43667825 GAGGATTGCTTAAACTCAGGAGG + Intergenic
1118263546 14:64271194-64271216 GAGGATTGCTTAAGCTCAGGAGG - Intronic
1120027093 14:79598726-79598748 GAGGAAAGATTGACATCATGTGG + Intronic
1121762093 14:96454566-96454588 GAGGAGTGCTTAAGCCCAGGAGG - Intronic
1121987397 14:98520813-98520835 GAGGAGTCATCAGCCTAATGGGG + Intergenic
1125204112 15:37131917-37131939 GACAAGTGGTTAACATCATGTGG - Intergenic
1127655837 15:61054924-61054946 GAGGATTGATTGAGCTCAGGAGG - Intronic
1129526240 15:76216933-76216955 GAGGAGTGATTGACCCCAGGAGG - Intronic
1129890605 15:79069275-79069297 GAGGAGTGAGGACCATCATGAGG - Intronic
1130130999 15:81142649-81142671 GATGAGTTACTATCCTCATGAGG - Intronic
1130177751 15:81592798-81592820 GAGAGGTGATTAATATCATGAGG + Intergenic
1131104356 15:89721462-89721484 GAGGATTGCTTAAGCTCAGGAGG + Intronic
1133135551 16:3708724-3708746 GAGGACTGCTTAACCTCGGGAGG + Intronic
1134542671 16:15080587-15080609 AAGGAAAAATTAACCTCATGTGG - Intronic
1135360257 16:21806721-21806743 AAGGAAGAATTAACCTCATGTGG - Intergenic
1136262554 16:29090227-29090249 AAGGAAGAATTAACCTCATGTGG + Intergenic
1140451183 16:75072026-75072048 GAGGACTGATTGAGCTCAGGAGG - Intronic
1141450207 16:84094371-84094393 TAGGTGTGATTAGCCGCATGTGG - Intronic
1142930247 17:3278376-3278398 TAGAAGTGATTGACCTCATTGGG + Exonic
1142945260 17:3421105-3421127 TAGAAGTGATTGACCTCATTGGG - Exonic
1143142401 17:4748569-4748591 GAGGGGTGTCTAACCTCATCTGG - Intergenic
1143209020 17:5169529-5169551 GAGGATTGATTGACCCCAGGAGG - Intronic
1144618507 17:16799004-16799026 GAGGATTGATTGACCCCAGGAGG - Intronic
1144894199 17:18516693-18516715 GAGGATTGATTGACCCCAGGAGG + Intergenic
1145138032 17:20427571-20427593 GAGGATTGATTGACCCCAGGAGG - Intergenic
1146382216 17:32339495-32339517 GAGGATTGATTAAGCCCAGGAGG + Intronic
1147070441 17:37951681-37951703 GAGGAGTGCTTGAGCTCAGGAGG - Intergenic
1149079810 17:52641707-52641729 GAGGTGTGATTAGCTTCATGGGG + Intergenic
1149871112 17:60182671-60182693 GAGGATTGATTGACCCCAGGAGG + Intronic
1151829214 17:76539950-76539972 GAGGACTGATTAAGCTCACTGGG - Intronic
1154045113 18:10896958-10896980 TAGGAGTGACTCACCTTATGTGG - Intronic
1154512110 18:15117352-15117374 GATGAGTGATTCAACTCATCAGG - Intergenic
1159454576 18:68644569-68644591 GAAAAGTGATTAGGCTCATGAGG + Intergenic
1162180072 19:8862701-8862723 GAGTGAGGATTAACCTCATGGGG - Intronic
1163484816 19:17579552-17579574 GACGTCTGATGAACCTCATGCGG + Exonic
1165869969 19:38964675-38964697 GAGGAGTGCTTGAGCTCAGGAGG + Intronic
1168667231 19:58213323-58213345 GAGGAGTTATTAACATCATTTGG + Exonic
925428972 2:3774653-3774675 GAGAGGTGATTGACCTCAGGTGG + Intronic
929203527 2:39263679-39263701 GAAGAGTGATTAAAATCTTGAGG + Intronic
930172216 2:48263549-48263571 GAGGATTGCTTAACCCCAGGAGG - Intergenic
930695027 2:54402574-54402596 GAGGAGTGATTTCTCTGATGGGG - Intergenic
932138621 2:69255114-69255136 GAGGATTGCTTAAGCCCATGAGG - Intergenic
932184885 2:69686008-69686030 TAGATGTGATTAACCTCAAGAGG + Intronic
932507532 2:72250430-72250452 GAGGATTGCTTGAGCTCATGAGG - Intronic
933153542 2:78945095-78945117 GAGGATTGCTTAAGCTCAGGAGG - Intergenic
938511678 2:131954120-131954142 GATGAGTGATTCAACTCATCAGG - Intergenic
938616315 2:133002722-133002744 GAGGAGTCAGTGACCTCAGGAGG - Intronic
938755522 2:134375759-134375781 CAGGAGTGATTGTCCACATGTGG + Intronic
942140189 2:172969426-172969448 GAGGAGGGTTTAACCTGGTGTGG + Intronic
944566555 2:200997290-200997312 TAGGAGTCCTTATCCTCATGAGG - Intronic
945293363 2:208146848-208146870 GAGGATTGCTTAAGCTCAGGAGG + Intergenic
947228522 2:227862947-227862969 GAGGAGAGTATAAGCTCATGAGG + Intergenic
947325961 2:228977044-228977066 GAGGATTGATTAAGCCCAGGAGG - Intronic
947886280 2:233574505-233574527 GAGGATTGATTGAGCCCATGAGG - Intergenic
1172046217 20:32082196-32082218 AATGAATGAATAACCTCATGGGG - Intronic
1172779624 20:37428367-37428389 AAGAAGTGATCAACCTCATCAGG - Intergenic
1173910254 20:46663353-46663375 GAGGATTGATTAAGCCCAGGAGG + Intronic
1174048758 20:47752659-47752681 GAGGATTGCTTAAGCTCAGGAGG + Intronic
1176782709 21:13217788-13217810 GATGAGTGATTCAACTCATCAGG - Intergenic
1177117224 21:17101073-17101095 GAAGAATGTTTGACCTCATGGGG - Intergenic
1177148211 21:17429131-17429153 GGGGAATGATTAACCACAGGAGG - Intergenic
1178109839 21:29358648-29358670 GAGGATTGCTTGACCTCAGGAGG + Intronic
1178990088 21:37346010-37346032 GAGGAGAGATAAAGCTTATGTGG + Intergenic
1180558201 22:16594204-16594226 GAGGATTGCTTAAGCTCAGGAGG + Intergenic
1181565982 22:23737976-23737998 TAGGAGTTATTAACCATATGTGG - Intergenic
1181596520 22:23918497-23918519 GAGGAGTCATTAACATCACAGGG + Intergenic
1182333473 22:29567764-29567786 GAGGATTGCTTAAGCTCAGGAGG + Intronic
1184079380 22:42207962-42207984 GAGGATTGCTTAAGCTCAGGTGG + Intronic
1184128982 22:42505993-42506015 GAGGAGTGCTTAGCCCCAGGAGG + Intergenic
1184137777 22:42559314-42559336 GAGGAGTGCTTAGCCCCAGGAGG + Intronic
1185018109 22:48357490-48357512 GAGGAGTGCTTACCCTGACGTGG - Intergenic
949715607 3:6927336-6927358 GAGAAGTGCTTAAACTCAGGAGG + Intronic
950292863 3:11801000-11801022 GAGGACTGCTTAACCTTAGGAGG + Intronic
951673337 3:25209250-25209272 GAGGAGTGAGTAACTTCCTCTGG - Intronic
952938149 3:38417376-38417398 TAGCAGTGATTAAACTCATTGGG + Intronic
954141033 3:48605612-48605634 CAGGAGAGGTTAAGCTCATGTGG + Intronic
955984221 3:64556408-64556430 GAGGATTGCTTAAGCTCAGGAGG - Intronic
956560211 3:70566664-70566686 GATGAGTGAATAAAGTCATGAGG + Intergenic
957449091 3:80352731-80352753 GGGGAGTGATAAACATGATGTGG + Intergenic
957726277 3:84071449-84071471 TAAGACTGATTAACTTCATGTGG - Intergenic
960898422 3:122530085-122530107 GAGGACTGATTGAACTCAGGAGG + Intronic
961181186 3:124879084-124879106 AAGGAGTGATCAACCGGATGCGG - Intronic
964690224 3:159442063-159442085 GAGTAGTGATTAGGCTGATGTGG + Intronic
967062640 3:185885774-185885796 GAGGAGAGAATAACTGCATGAGG - Intergenic
971074230 4:23129430-23129452 CAGGAGTGATTCAGCTCAAGAGG - Intergenic
972945331 4:44247306-44247328 TAGGAGTGATTAATTGCATGGGG - Intronic
973951692 4:56021938-56021960 GAGGATTGATTGAGCTCAGGAGG + Intronic
976413640 4:84746225-84746247 GAGGATTGATTGACCTCAGCAGG + Intronic
976828377 4:89285053-89285075 GAGGAGTGACTCAGCTCAAGGGG + Intronic
984771526 4:183440814-183440836 GTGGAGAGATTAACCTTAGGTGG - Intergenic
984842640 4:184082298-184082320 GAGAAGTGATTTACCTTATTGGG + Intergenic
985704185 5:1391165-1391187 GAGGAGTGAGGAGCCACATGTGG - Intergenic
990532253 5:56686122-56686144 GCAGAGTGATTATCATCATGGGG + Intergenic
991277820 5:64871443-64871465 GAGGAGTGTTTTAGGTCATGAGG + Intronic
991949064 5:71930454-71930476 AAGGAGTGAATAAACTCAAGAGG - Intergenic
993371644 5:87099829-87099851 GTGGATTGGTTAAGCTCATGAGG + Intergenic
994179925 5:96753081-96753103 GAGGATTGCTTGACCTCAGGAGG - Intronic
995834312 5:116385267-116385289 GAGAATTGATTAAACTCAGGAGG - Intronic
995856059 5:116593565-116593587 CGGGAGTGATTAACCAAATGGGG - Intergenic
997298883 5:132787895-132787917 GAGGATTGATTAAGCCCAGGAGG - Intronic
997854710 5:137363037-137363059 GAGGATTGATTACTGTCATGAGG - Intronic
999608383 5:153342243-153342265 AAGGATTGGTTAACCTTATGTGG + Intergenic
1001596377 5:172901435-172901457 GAATAATTATTAACCTCATGAGG + Intronic
1004810624 6:19257300-19257322 GAGGAGTGAGCAACCTTCTGAGG - Intergenic
1009569351 6:65362229-65362251 GGGGAGTTATTAACCACATATGG + Intronic
1010163280 6:72884704-72884726 GAGGATTGATTAAGCCCAGGAGG - Intronic
1012000865 6:93652827-93652849 GAAGAATGATTACCCTCATCTGG - Intergenic
1012333643 6:98026545-98026567 AAGGACTGATTGAGCTCATGAGG - Intergenic
1013772244 6:113640884-113640906 CAGGAGTGAGTCACCTCATCTGG - Intergenic
1015662006 6:135586249-135586271 GTGGAGTGAATATTCTCATGAGG + Intergenic
1015866380 6:137731005-137731027 GAGGAGTGCTTAAGCCCAGGAGG - Intergenic
1019955867 7:4413996-4414018 GAGGATTGATTGAGCCCATGAGG - Intergenic
1020504922 7:8973811-8973833 GAGGATTGCTTAATCTCAGGGGG - Intergenic
1022302619 7:29115347-29115369 GAGGAGGGATAGACCTCATTGGG - Intronic
1022962660 7:35444533-35444555 GAGGATTGATTGAGCTCAGGAGG - Intergenic
1027840912 7:83310082-83310104 AAGGGTTGATTGACCTCATGAGG + Intergenic
1028736441 7:94218560-94218582 GAGGAGTGATTGTCATGATGGGG + Intergenic
1029136207 7:98374040-98374062 GAGGAGTGCTTGATCTCAGGAGG - Intronic
1030780206 7:113591558-113591580 GAGGATTGATTGAGCTCAGGAGG + Intergenic
1032713517 7:134484109-134484131 GAGGATTGCTTAACCCCATGAGG - Intergenic
1033954923 7:146835014-146835036 CTGTAGTGATTAACCTCAAGGGG - Intronic
1034619111 7:152443793-152443815 GAGGACTGCTTAAGCTCAGGAGG - Intergenic
1036136922 8:6170437-6170459 GAGTAGTGAAGAAGCTCATGAGG - Intergenic
1040845149 8:51830043-51830065 AGGGAGTGATGAACCTAATGGGG - Intronic
1041684586 8:60631653-60631675 GAGGACTGATTGAGCCCATGAGG - Intergenic
1044786799 8:95802746-95802768 GAGAAGTGATTGAACTCATGAGG + Intergenic
1045254369 8:100507441-100507463 GAGGATTGCTTAAGCTCAGGAGG - Intergenic
1046079194 8:109350346-109350368 GAGGATTGCTTGAGCTCATGAGG + Intergenic
1047221276 8:122920648-122920670 GAAGAGTATATAACCTCATGTGG - Intronic
1049609331 8:143546352-143546374 GAGGAGTGGTTGAGCTCAGGAGG + Intergenic
1060907877 9:127324159-127324181 GAGGATTGCTTGAGCTCATGAGG + Intronic
1061592055 9:131603943-131603965 GAGGAGTAAGTAACCTCGGGCGG - Intronic
1187892261 X:23947191-23947213 GAGGATTGCTTAAGCTCAGGAGG + Intergenic
1190223926 X:48531239-48531261 GAGGATTGATTAAGCCCAGGAGG + Intergenic
1192413140 X:70952828-70952850 GAAGATTGATTGAGCTCATGAGG + Intergenic
1196836967 X:119822695-119822717 GAGAATTGATTAAACTCAGGAGG - Intergenic
1198548617 X:137720440-137720462 GTGGAGTGCTAAACCTCTTGTGG - Intergenic
1199205446 X:145144192-145144214 GAGGATAGCTTTACCTCATGAGG - Intergenic
1200344893 X:155438319-155438341 GAGGAGTGTTTTACTTTATGTGG - Intergenic
1201420733 Y:13795820-13795842 GAGGAGTTATTAACATCCAGTGG + Intergenic