ID: 907393569

View in Genome Browser
Species Human (GRCh38)
Location 1:54174447-54174469
Sequence ATGGGGCAGATGAGAAGTAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 311}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907393560_907393569 20 Left 907393560 1:54174404-54174426 CCTCCTTCTACATAGTAGGAGGC 0: 1
1: 0
2: 2
3: 6
4: 112
Right 907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG 0: 1
1: 0
2: 4
3: 21
4: 311
907393556_907393569 25 Left 907393556 1:54174399-54174421 CCCATCCTCCTTCTACATAGTAG 0: 1
1: 0
2: 0
3: 12
4: 147
Right 907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG 0: 1
1: 0
2: 4
3: 21
4: 311
907393561_907393569 17 Left 907393561 1:54174407-54174429 CCTTCTACATAGTAGGAGGCCAG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG 0: 1
1: 0
2: 4
3: 21
4: 311
907393564_907393569 -2 Left 907393564 1:54174426-54174448 CCAGGAGGAGTGATTAACCTCAT 0: 1
1: 0
2: 0
3: 4
4: 76
Right 907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG 0: 1
1: 0
2: 4
3: 21
4: 311
907393557_907393569 24 Left 907393557 1:54174400-54174422 CCATCCTCCTTCTACATAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 184
Right 907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG 0: 1
1: 0
2: 4
3: 21
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907393569 Original CRISPR ATGGGGCAGATGAGAAGTAG AGG Exonic
900601213 1:3503463-3503485 AAGGGGCAGAGGAGGAGCAGAGG + Intronic
902046083 1:13525633-13525655 ATGGGGCAGAAGAGGAGCTGCGG + Intergenic
902448465 1:16482503-16482525 TAGGGGCAGTTGGGAAGTAGAGG + Intergenic
905391607 1:37639359-37639381 GTGGGGCAGTTGAGATGTTGAGG - Intergenic
905893653 1:41531908-41531930 ATGGAGGACATGAGAGGTAGAGG + Intronic
907194996 1:52679316-52679338 CTGGGGCAGGGGAAAAGTAGGGG - Intergenic
907393569 1:54174447-54174469 ATGGGGCAGATGAGAAGTAGAGG + Exonic
907574786 1:55516537-55516559 ATGAGGAAAGTGAGAAGTAGGGG + Intergenic
908798942 1:67858959-67858981 TTGGGGCAGACGTGAAGTAAGGG + Intergenic
909600528 1:77456766-77456788 ATGGGGCAGGTGAGAAGAGCAGG - Intronic
909795348 1:79728623-79728645 ATGGGGCACGTGGGAAGTACTGG + Intergenic
912749081 1:112270491-112270513 ATGGGGCAGGGGAGCAGCAGTGG + Intergenic
913252524 1:116923827-116923849 ATGGGGCAGATAATAAATAGTGG - Intronic
914991477 1:152502766-152502788 GTGGGGCAGATGATGAATAGAGG + Intergenic
915629909 1:157145037-157145059 ATGGAGTAAATGAGAAGCAGGGG - Intergenic
916324421 1:163540983-163541005 ATGGTACAAATGATAAGTAGAGG - Intergenic
917031198 1:170693824-170693846 ATGGGGAAAATGAGATGTAGCGG + Intronic
918386756 1:184015721-184015743 GTGGGGCTGATGTGAAGGAGAGG + Intronic
919979753 1:202635481-202635503 ATGGGGCAGAAGAAACATAGTGG + Intronic
920500360 1:206481430-206481452 ATGGGGCAGCTGGGAGGTGGAGG + Intronic
920588299 1:207190453-207190475 ATGGGGAAGAAGAGAACAAGAGG + Intergenic
920665842 1:207962636-207962658 ATGGGGCAGCTGGGATGTAGGGG + Intergenic
921148280 1:212379600-212379622 CTGGGGCTGCTGAGGAGTAGGGG - Intronic
922062057 1:222102240-222102262 ATGGGGCAGAATAGAGGTATGGG - Intergenic
922923617 1:229329606-229329628 ATGGGTGAGATCAGAAATAGGGG + Intronic
923030741 1:230247372-230247394 AGGGGGAAGCTGAGAAGCAGAGG - Intronic
1063136489 10:3221404-3221426 ATGGGGCAGAAAAGAAGTCAAGG + Intergenic
1063869099 10:10399113-10399135 ATGGGGCACATGAGATGTTTTGG + Intergenic
1064695866 10:17964717-17964739 CAGAGGCAGATGAGAAGTAGAGG + Intronic
1064744461 10:18464932-18464954 ATGGGGCAGATGGGAAGGCCAGG + Intronic
1064882499 10:20071864-20071886 AAGAGGCAGTTGAGAAGAAGTGG + Intronic
1068804407 10:61178551-61178573 ATGGGTCAGATTGGAAGCAGGGG + Intergenic
1069772268 10:70907480-70907502 TGGGGACAGATGAGAAATAGAGG - Intergenic
1071138024 10:82473927-82473949 AAGGCCCAGAGGAGAAGTAGGGG + Intronic
1071235328 10:83639884-83639906 CTGGTGCAGATGACCAGTAGAGG + Intergenic
1075449379 10:122538804-122538826 ATGGGAGATATGAGAAGTAGGGG + Intergenic
1077009037 11:371952-371974 AGGAAGCAGATGAGAAGGAGAGG + Intronic
1077515157 11:2997087-2997109 ATAGGGCAGAAGAGAAGGACTGG - Intergenic
1078108628 11:8374190-8374212 CTGGGGCAGGTGAGAGGTAGTGG - Intergenic
1078389463 11:10924345-10924367 ATGTGACAGAAAAGAAGTAGGGG - Intergenic
1078998045 11:16724310-16724332 CTGAGGCAGAGTAGAAGTAGTGG - Intronic
1081066859 11:38553120-38553142 TTGGGGTTGAGGAGAAGTAGTGG + Intergenic
1081179563 11:39969107-39969129 AGGGGGCAGATGGCAAGTATAGG + Intergenic
1085543909 11:77299182-77299204 ATGGGGCTGGTGAGAAGCTGTGG - Intronic
1085618905 11:78022815-78022837 GTGGGGCAGAGGAGGAGTCGTGG + Intronic
1087771687 11:102217651-102217673 GTAGGGGAGGTGAGAAGTAGTGG + Intronic
1090245713 11:125214643-125214665 ATGGTGCAGATGCTAACTAGGGG - Intronic
1090333748 11:125949737-125949759 GTGGGGCAGAAGAGAGGTAGGGG - Intergenic
1091556900 12:1580786-1580808 AGGGGGCAGATTAGCATTAGCGG + Intronic
1091800725 12:3323073-3323095 AAGGGGCAGAGGAGGAGGAGAGG + Intergenic
1091990128 12:4948391-4948413 AAGGGGGAGAGGAGAAGAAGAGG + Intergenic
1093738784 12:22656629-22656651 ATGGAGCAGACGAGAAGTCATGG + Intronic
1094010882 12:25808169-25808191 ATGGGACAGAGGACAAGGAGAGG + Intergenic
1094043372 12:26141201-26141223 AGGAGGCAGAAGAGAATTAGAGG + Intronic
1095221001 12:39614497-39614519 AAGGGGAAAATGTGAAGTAGAGG - Intronic
1095906089 12:47379599-47379621 ATGGGACTAATGAGACGTAGGGG + Intergenic
1097081343 12:56433481-56433503 ATGGGGCAGTGGTGAAGAAGTGG - Intronic
1097927874 12:65150509-65150531 ATGGGGAAGATGAATAGAAGCGG - Intergenic
1099728865 12:86471537-86471559 AAGGAGAAAATGAGAAGTAGAGG + Intronic
1100591420 12:96034138-96034160 ATCGGGCAGATAAGAATTGGTGG - Intronic
1101200533 12:102431044-102431066 ATGGGGGAGATGAGAAGGCTGGG - Intronic
1101863381 12:108500669-108500691 TTGGGGTAGAAGAGAGGTAGAGG + Intergenic
1102980529 12:117237465-117237487 ATGGGCCATATGAGAAGTACAGG + Intronic
1103221850 12:119252852-119252874 GTGGGGCTGGTGAGAAGTAGTGG - Intergenic
1104085318 12:125469545-125469567 ATGAGGCCAGTGAGAAGTAGAGG + Intronic
1105845623 13:24291475-24291497 ATGGGGCAGCTGAGAAGACCAGG + Intronic
1106923135 13:34586279-34586301 ATTGGGGAGATGAGAAGCCGAGG + Intergenic
1107055430 13:36098637-36098659 TTGGGGCACAAGAGAAATAGAGG - Intronic
1107175213 13:37391907-37391929 AAGGGGCAGAGAAGGAGTAGGGG + Intergenic
1108860338 13:54850459-54850481 AAGGGGAAAAAGAGAAGTAGGGG + Intergenic
1109304560 13:60624474-60624496 ATGGGGAAGAAGAGAAGCAAAGG - Intergenic
1109990159 13:70043889-70043911 ATGAGTCAGATTAGAAGTGGTGG - Intronic
1110120149 13:71869855-71869877 TTGGGGAAGATGAGATGGAGAGG - Intergenic
1111664062 13:91245213-91245235 TTGAGACAGATAAGAAGTAGAGG - Intergenic
1112551259 13:100423213-100423235 AAGGGGCAGATGTGGAGTGGAGG - Intronic
1113748419 13:112762182-112762204 CTGGGGCAGAGGAGGAGGAGGGG - Intronic
1114615967 14:24068638-24068660 ATGGGGAAGAGGAGAAGGAGGGG + Exonic
1116323819 14:43504829-43504851 GTAGGGCATATGAGAAATAGTGG + Intergenic
1118729840 14:68658525-68658547 TTGGTGCAGATGAGATGAAGGGG - Intronic
1119370225 14:74133994-74134016 ATGGAGCTGATGAAAAGTTGAGG - Intronic
1119623553 14:76151753-76151775 ATGGGGCAGGGGACAAGGAGGGG - Intergenic
1120425185 14:84338828-84338850 ATAGGGGAGAAGAGAAGGAGTGG - Intergenic
1120647116 14:87087233-87087255 AGGGGGCAGGAGAGAAGTAAGGG - Intergenic
1121445603 14:93976952-93976974 AAGGGGAAGAGGAGAAGTAAAGG + Intergenic
1124429413 15:29593465-29593487 AGGGGGCAGCTGAGATGGAGTGG - Intergenic
1124495372 15:30183519-30183541 ATGGGGCAGATGAAATATAGTGG + Intergenic
1124748201 15:32355127-32355149 ATGGGGCAGATGAAGTATAGTGG - Intergenic
1125389026 15:39172027-39172049 AGAGGGAAGAGGAGAAGTAGGGG + Intergenic
1125632847 15:41162120-41162142 ATGGAGGAGATGAGAAGGTGAGG + Intergenic
1125747833 15:42009338-42009360 GCAGGGCAGATGAGAAGTTGGGG - Intronic
1126472095 15:49023897-49023919 ATGGGGGAGAGGAGAAGTCAAGG + Intronic
1127153387 15:56102828-56102850 ATGGAGGAGATGAGAGGAAGGGG - Intronic
1127277500 15:57460337-57460359 AATGGGCAGTTGTGAAGTAGAGG + Intronic
1127535433 15:59885764-59885786 ATGGGGCAGGGGAGGACTAGGGG + Intergenic
1127921815 15:63500685-63500707 AAGGGGTAAATGGGAAGTAGTGG + Intergenic
1128012871 15:64315135-64315157 TTGGTGCGGATGAGAAGAAGAGG + Intronic
1128319553 15:66683507-66683529 ATGAGGCAGATGAGCAGTGTTGG + Intronic
1131131431 15:89903216-89903238 ATGGGGCAGAGGACGAGGAGTGG - Exonic
1131558796 15:93421933-93421955 ATGGGGAGGATGAGGAGTAAGGG - Intergenic
1132305157 15:100806783-100806805 ATGGGGCAGATGAGATTTAAAGG + Intergenic
1133508936 16:6439488-6439510 AAGGGGCAGAAGGGAAGCAGGGG - Intronic
1134280362 16:12811618-12811640 CTGGGGCAGATGAGAAACAAGGG - Intergenic
1135094851 16:19556258-19556280 ATGGGGCAGACGCACAGTAGAGG + Intronic
1135788288 16:25370482-25370504 ATGATGCAGAAGAGAGGTAGAGG + Intergenic
1135916953 16:26613823-26613845 ATTGGGCAGATGAGTAGAAATGG - Intergenic
1136063944 16:27746430-27746452 AAATGGCAGATGAGAAGTGGGGG + Intronic
1137651646 16:50125499-50125521 ATGGGGCAGAGGAGAAACACTGG + Intergenic
1138289418 16:55833897-55833919 ATGGGGTGGAGGAGCAGTAGGGG + Intergenic
1139190538 16:64857917-64857939 ATGAGGGAGAGGAGAAGAAGAGG + Intergenic
1141205039 16:81927007-81927029 CGGGTGCAGATGAGCAGTAGTGG + Intronic
1141617177 16:85216619-85216641 CTGGGACAGATGAGAAATTGAGG + Intergenic
1142112707 16:88340773-88340795 GTGGGGCAGAGGAGAGGGAGAGG + Intergenic
1146090356 17:29871124-29871146 ATGGGGCATCTGAGAAGTCACGG + Intronic
1149980773 17:61309528-61309550 ATGGTGAAGCTGGGAAGTAGAGG - Intronic
1151744253 17:76003167-76003189 ATGGGGAAGAAGAGAAGGTGTGG - Intronic
1151933736 17:77248718-77248740 AAGGGGCAGATGGTGAGTAGGGG - Intergenic
1152013714 17:77735966-77735988 ATGGGGGAGAAGAGAAGGGGAGG + Intergenic
1153249834 18:3110268-3110290 ATGGGACAGAATAGAAGCAGAGG + Intronic
1155283228 18:24262712-24262734 AAGGGGCACATGAGAACTTGGGG - Intronic
1156449689 18:37259785-37259807 CAGGGGCAGATGAGAAAGAGAGG - Intronic
1156527473 18:37780045-37780067 ATGGGACATGTGAGAATTAGAGG - Intergenic
1157081817 18:44533796-44533818 ATGTGGAATATGAGGAGTAGAGG - Intergenic
1157436261 18:47672135-47672157 ATGGGTCAGGCCAGAAGTAGGGG + Intergenic
1158474825 18:57770602-57770624 ATGGGATAGAGGAGAAGGAGAGG + Intronic
1159684031 18:71394222-71394244 ATGAGATAGATGAGAAATAGAGG - Intergenic
1159833017 18:73301362-73301384 ATGGCGAAGATGAGAAGGAAAGG + Intergenic
1162896706 19:13768795-13768817 AGGGGGCGTATGAGAAGTTGGGG - Intronic
1163115168 19:15184856-15184878 AGGGGGCAGAGGAGATGGAGAGG + Intronic
1163683372 19:18696501-18696523 ATGGCACAGATGAGAAATTGAGG + Intronic
1165263306 19:34639079-34639101 TTGGGGCAGAAGAAAATTAGGGG - Intronic
1166047306 19:40237004-40237026 GTGGTACAGATGGGAAGTAGAGG - Intronic
1166201601 19:41241024-41241046 GAAGGGCAGATGAGAAGTATGGG - Intronic
1166695461 19:44849041-44849063 ACTGGGCAGAGGAGAAGTTGGGG + Intronic
1167117547 19:47496999-47497021 AGGGGGCAGATGAGGAGGAAGGG + Intronic
1167531727 19:50021912-50021934 TTTGGGGAGATGAGAAGCAGAGG + Intronic
1167617950 19:50546540-50546562 GTGGGGAGGATGAGAAATAGAGG + Intronic
1168138357 19:54367052-54367074 ATGGGGTAGATGAGATGTTTTGG - Intronic
1168712673 19:58510939-58510961 ATGGGTCAGAGGAGAAACAGAGG + Intronic
926660086 2:15455274-15455296 ATAGGGCATATGAGAAAAAGGGG - Intronic
926924560 2:17974007-17974029 CTGGGGCAGAGGAGTAGAAGGGG + Intronic
927855263 2:26523790-26523812 ATGGGGCAGCTGAGTGGAAGGGG - Intronic
929020567 2:37548402-37548424 GTGTGGCAGAGGAGAATTAGAGG - Intergenic
929858980 2:45659299-45659321 ATGGGGCACCTGAGAATTACAGG - Intronic
930155759 2:48106331-48106353 ATAGGGCAAGTGAGGAGTAGAGG + Intergenic
930954367 2:57187272-57187294 ATGGGGAAGATGAGGAGAAAAGG + Intergenic
931460840 2:62448798-62448820 ATGGGGCAGGTGAGGAGTCCAGG - Intergenic
932784046 2:74584043-74584065 ATGAGGCAGATGAGAGTTTGGGG - Intronic
932861391 2:75296187-75296209 ATGGGAAAGGAGAGAAGTAGAGG - Intergenic
934869967 2:97854691-97854713 ATGGGTGAGAGGAGAAGTAAGGG - Intronic
935305909 2:101736165-101736187 AGGGAGCAGATCAGATGTAGGGG - Intronic
937255303 2:120551286-120551308 ATGGGGCAGAGGAGAATATGGGG + Intergenic
938710064 2:133968648-133968670 ATGGGGAATAGGGGAAGTAGGGG - Intergenic
938974367 2:136461202-136461224 GTTGGCCAGCTGAGAAGTAGAGG - Intergenic
939719626 2:145632604-145632626 ATTGGGCAGATAAGAAAAAGGGG + Intergenic
939765848 2:146248846-146248868 ATGAGGCAGATGAAAGGTGGAGG + Intergenic
939978532 2:148749548-148749570 ATGGGGCAGACCACAAGCAGTGG + Intronic
940067974 2:149651115-149651137 ATGGAGCAGATGAGCACTCGTGG + Intergenic
940672004 2:156681899-156681921 ATGTGGCAGACTGGAAGTAGCGG - Intergenic
942546248 2:177067217-177067239 GTGGGGAAGAATAGAAGTAGTGG + Intergenic
942817226 2:180065981-180066003 ATGGAGCAGAAGAGAAGGGGAGG + Intergenic
945443114 2:209904277-209904299 ATTGGCCAGAGGAGAAGAAGTGG + Intronic
945606838 2:211943666-211943688 ACAGGGTAGATGATAAGTAGAGG - Intronic
946284094 2:218689727-218689749 AAGGGACAGAAGAGAAGTATAGG - Intronic
946950358 2:224867543-224867565 ATATGGAAGATGAGAAGAAGGGG + Intronic
947057164 2:226118274-226118296 ATAGGACAAATGAGAAGCAGGGG - Intergenic
947859138 2:233346537-233346559 AGGGAGCAGACGGGAAGTAGCGG - Intronic
1168758094 20:329711-329733 ATCTGACAGATGAGAATTAGGGG - Exonic
1169044980 20:2528002-2528024 ATGGGGCAGCTGACAAGGCGAGG + Intergenic
1169208144 20:3751458-3751480 AGGGGGCAGAGGAGAAGGGGCGG - Intronic
1169738834 20:8867784-8867806 ATAAGGCAATTGAGAAGTAGTGG - Intronic
1170756785 20:19212442-19212464 AGGGGGCAGAGGAGGAGGAGCGG - Intergenic
1173710252 20:45149349-45149371 ATGGGAAAGATGAGAAGTTTGGG - Intergenic
1173874765 20:46363613-46363635 ATGGAGAGGAAGAGAAGTAGAGG - Intronic
1174105036 20:48155900-48155922 ATGGAGCTGATATGAAGTAGAGG + Intergenic
1174173208 20:48629608-48629630 ATGGGGCGGATCAGCTGTAGGGG + Exonic
1174375544 20:50124452-50124474 TGGGGGCAGCAGAGAAGTAGGGG + Exonic
1175595154 20:60225143-60225165 AGAGGGCAGATGAGAGGCAGGGG + Intergenic
1175603793 20:60296252-60296274 ATGAGCCAGATGAGAAATGGGGG + Intergenic
1178979925 21:37255012-37255034 ATGGGGCAGCAGAGGAGAAGGGG + Intronic
1181773509 22:25143659-25143681 ATGGGGCAGAGGACAGTTAGGGG - Intronic
1182117352 22:27764488-27764510 ATTGTGCAGAGGGGAAGTAGAGG - Intronic
1182788757 22:32931080-32931102 ATGCTGCAGATGAGAAGTAGAGG + Intronic
1182937484 22:34239122-34239144 AGGGGGAAGAAGAGAAGTAAGGG + Intergenic
1183599982 22:38834367-38834389 TTGGGGCAGTTGAGCAGCAGAGG - Intronic
1184288455 22:43485565-43485587 AGGGGGCAGAAGAGAAATCGTGG - Intronic
1184355357 22:43975899-43975921 AAGGGGAAGAAGAGAAGAAGGGG - Intronic
1184468595 22:44683257-44683279 AAGGGGCAGATGACAGGAAGGGG - Intronic
1184945561 22:47801599-47801621 ATGGGGAGGATGAGAAGCAGGGG - Intergenic
949180132 3:1119070-1119092 ATGTGGCAGATTTGAAGGAGAGG + Intronic
949400024 3:3656338-3656360 AAGTGGCAGATGAGAAGTACCGG + Intergenic
949538489 3:5013764-5013786 ATGAGGCAGAGGAGGAGGAGGGG - Intergenic
950225587 3:11230995-11231017 ATGGGGGAGGTGAGAAGGAAAGG - Intronic
950563010 3:13746683-13746705 ATGGTGCAGAGGAGAAGAACAGG + Intergenic
952629237 3:35444665-35444687 ATGGAGCAGATTGGAACTAGGGG + Intergenic
952986937 3:38794092-38794114 ATGGGACAGATGAGAGGGACAGG - Intergenic
953849487 3:46455073-46455095 GTGGGGCTGGTGAGAAGTTGGGG + Intronic
953939678 3:47082017-47082039 GTGGGGAAGATAAGAAGAAGGGG + Intronic
954073509 3:48160006-48160028 AAGGGGCAGAGCAGCAGTAGGGG - Intronic
954446163 3:50547942-50547964 CTGGGGCAGGTGAGAAGGATGGG - Intergenic
955408713 3:58642281-58642303 ATGGGTCAGGGGAGAAGTCGAGG - Intronic
955594072 3:60569637-60569659 ATGGGGAAACTGAGATGTAGGGG - Intronic
956295999 3:67714300-67714322 ATGGGGCAGAGGAGAAATGCAGG + Intergenic
957343710 3:78934854-78934876 ATGGTTCAGATGAGATGAAGTGG - Intronic
957618163 3:82559799-82559821 AGGAGGAAGAAGAGAAGTAGGGG + Intergenic
958012711 3:87900713-87900735 ATAAGGCAAAAGAGAAGTAGAGG + Intergenic
959984641 3:112559231-112559253 TTGGTGGAGATGAGAATTAGAGG - Intronic
960438664 3:117659291-117659313 ATGGGGCAGATGAAAAGAACAGG + Intergenic
962313454 3:134342394-134342416 ATGGAGAAGCTGAGAAGTGGAGG + Intergenic
966461866 3:180185303-180185325 ATTGTTCAGATGAGATGTAGAGG - Intergenic
966623940 3:181996511-181996533 TGGGAGCAGATGAGAAATAGTGG + Intergenic
966642095 3:182203066-182203088 ATGGGGCAGAGGGGAGGGAGAGG + Intergenic
967735293 3:192945369-192945391 ATGGGGCAGATGGGAACAGGTGG + Intergenic
969226317 4:5800728-5800750 ATGGGGCAGAGGAGAAGGAAAGG + Intronic
969617493 4:8262188-8262210 ATGGGGCAGGGGTGAAGCAGGGG + Intergenic
971052541 4:22877517-22877539 AGGAGGCATATGAGAAGGAGGGG - Intergenic
971591168 4:28471645-28471667 ATGGTAGAGATTAGAAGTAGTGG + Intergenic
971782959 4:31061933-31061955 CTGGAGCAGAAGAGAAGCAGAGG - Intronic
972109119 4:35533173-35533195 ATGGAGAAGATGAGAAGGATTGG + Intergenic
972663323 4:41139723-41139745 ATGGGGCAAAAGATAAGTAGTGG + Intronic
973633228 4:52838780-52838802 CTGGGGCAGGTGAGAAGGGGTGG + Intergenic
973807259 4:54538397-54538419 ATGGGGCAGATGGAAGGAAGGGG - Intergenic
974057005 4:56993402-56993424 ATGGCACAGATAAGGAGTAGAGG + Intronic
975454530 4:74574815-74574837 CTGGGGCAGATCAGAAGGACTGG - Intergenic
978427960 4:108602045-108602067 ATGTGGCAAAGGAGAAGTAAGGG + Intergenic
978462613 4:108973713-108973735 AAGGCACAGATGTGAAGTAGAGG + Intronic
980345246 4:131607620-131607642 ATGGGGCAGATGGTGAGTACAGG + Intergenic
982479104 4:155887278-155887300 ATGTGGCATGTGATAAGTAGAGG - Intronic
982563711 4:156963087-156963109 GTGGGGCAGAGGCAAAGTAGAGG - Intronic
983439546 4:167763974-167763996 ATAAGGGAGATGAGAAGTATGGG - Intergenic
984703171 4:182831885-182831907 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703182 4:182831916-182831938 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703193 4:182831947-182831969 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703224 4:182832042-182832064 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703235 4:182832073-182832095 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703246 4:182832104-182832126 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703257 4:182832135-182832157 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703268 4:182832166-182832188 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703279 4:182832197-182832219 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703295 4:182832244-182832266 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984703306 4:182832275-182832297 AGGGGGGAGAGGAGAAGGAGGGG - Intergenic
984946515 4:184972861-184972883 TTGGGGCAAATGGGAAGAAGAGG - Intergenic
986797239 5:11223970-11223992 ATGGGACAGATGAGAAGCAGGGG - Intronic
987077613 5:14398557-14398579 AGAGGGCTGAAGAGAAGTAGAGG + Intronic
989364660 5:40642427-40642449 ATGGTGAAGATGAAAACTAGTGG - Intergenic
989667027 5:43866530-43866552 ATGAGGCAGAAGATAAGTAGGGG + Intergenic
990528310 5:56650261-56650283 ATGCGGCGGAGGAGAAGTCGGGG + Intergenic
990669347 5:58110029-58110051 ATCGGGCAGATGAAAAAAAGAGG - Intergenic
992363646 5:76069550-76069572 CTGGGGCACATGACAAGTGGAGG - Intergenic
994385757 5:99129672-99129694 ATGGGGCAGATGTGAAAGATGGG - Intergenic
995541113 5:113187135-113187157 ATGGGGCATATGAGGAGTGGAGG - Intronic
995573738 5:113508304-113508326 ATGGGCCAGAGGAGAGGAAGGGG + Intergenic
995964994 5:117894777-117894799 ATGTGGCAGATCTAAAGTAGAGG - Intergenic
996292373 5:121867317-121867339 ATGGGGGAGAGGAGAGGAAGAGG - Intergenic
996455043 5:123672008-123672030 AGGGGCCAGAGGAGAAGAAGGGG - Intergenic
996625029 5:125560587-125560609 ATGAGGCAAATGAGAATGAGAGG + Intergenic
998014823 5:138723781-138723803 ATGGAGCAGGTGAGAAAGAGGGG + Intronic
999369169 5:151042769-151042791 ATGGCCCAGAGGAGAAGTTGGGG - Intronic
999503085 5:152166181-152166203 AAGTGGCAGATCAGAATTAGTGG + Intergenic
1003483743 6:6556635-6556657 AAGGGGCAGATGGGATGGAGGGG - Intergenic
1004063194 6:12218325-12218347 ATGGGGCAGATGAGAGCTTCAGG - Intergenic
1004718004 6:18237578-18237600 AAGGGGCATAGGGGAAGTAGAGG - Intronic
1005822967 6:29612976-29612998 ATGAGTCAGATGAGAACTATAGG - Intronic
1007519983 6:42444552-42444574 AGGGGGCAGATGCTAAGGAGTGG - Intronic
1008508991 6:52258669-52258691 GTGGGGCAGATGAGAAGCGACGG - Intergenic
1008588015 6:52966505-52966527 ATGGAGCAGATGAACAGGAGTGG - Intergenic
1009360537 6:62805778-62805800 CTGTGGCAGAGGAAAAGTAGCGG - Intergenic
1010114190 6:72282268-72282290 AGTGGGAAGATGAGAAGTAAGGG - Intronic
1010264899 6:73855182-73855204 AGGGGGCAGAAGAGGATTAGAGG + Intergenic
1011878934 6:91998784-91998806 AGAGGGCAGATGGGAAGCAGTGG + Intergenic
1019171061 6:170133451-170133473 AATAGGCAGATGAGAAGTGGGGG - Intergenic
1019171105 6:170133623-170133645 AATAGGCAGATGAGAAGTGGGGG - Intergenic
1020222563 7:6251359-6251381 ATGAGGCAGGAGAGAAGGAGGGG + Intronic
1020478257 7:8624830-8624852 GTGGGGAAGCTGAGTAGTAGAGG + Intronic
1021580040 7:22142780-22142802 ATGGGGATGGTGAGAAGGAGGGG + Intronic
1021959036 7:25854069-25854091 GAGAGGCAGATGAGAAGTGGAGG + Intergenic
1023535746 7:41207424-41207446 AGGGGACAGATGAGAAGCACAGG - Intergenic
1023638322 7:42235935-42235957 ACTGGGGAGATGAGAAGTTGGGG + Intronic
1023901821 7:44487478-44487500 AAGAGGCAGATGAGTAGGAGTGG + Intronic
1025016160 7:55440605-55440627 ATGGGGAAGCTGAAAAGCAGAGG - Intronic
1025999235 7:66548488-66548510 AGAGGGCAGGTGAGAAGGAGGGG + Intergenic
1026128872 7:67604124-67604146 ATGGGGCAGAGGAGGGGAAGAGG + Intergenic
1026314806 7:69219106-69219128 ATGGAGCAGATTAGAAGGTGAGG - Intergenic
1026435490 7:70393396-70393418 ATGGGGCAGATGAGCAGGAAGGG - Intronic
1026501172 7:70944597-70944619 CTGGGGCAGAAGAGGAGAAGTGG - Intergenic
1026652521 7:72227825-72227847 ATTATGAAGATGAGAAGTAGAGG + Intronic
1026992416 7:74594626-74594648 AGGGAGCAGGTGAGAAGGAGGGG + Intronic
1028328001 7:89550295-89550317 GGGGAGCAGATGAGAAGGAGTGG - Intergenic
1028426539 7:90696096-90696118 GTGGAGCTGCTGAGAAGTAGTGG + Intronic
1029173064 7:98644260-98644282 ATGGGGCACAGGAGAGGAAGAGG - Intergenic
1030100448 7:105940926-105940948 TTGGGGAAGAAGAGAAGTACAGG - Intronic
1030930320 7:115515645-115515667 ATGGAGGTGATGAGAAGTGGTGG - Intergenic
1031064290 7:117088032-117088054 ACAGGGCGGATGAGAAGCAGTGG - Intronic
1032161999 7:129518077-129518099 CAGGGGGAAATGAGAAGTAGTGG + Intergenic
1032499604 7:132390672-132390694 ATGGGGCAGAGAAGAAGCGGGGG - Intronic
1033258450 7:139821746-139821768 ATGGGGCCGAAGAGAGGGAGGGG + Intronic
1033368203 7:140687233-140687255 ATGGGGCAGGTGAGACGCACTGG + Exonic
1034721346 7:153296564-153296586 AAGGGGAAAATGAGGAGTAGTGG + Intergenic
1035917914 8:3645031-3645053 ATGAGGCAGATGAGGAGTAGAGG - Intronic
1038060355 8:23905467-23905489 AGGAGGCAGAGGAGAAGAAGAGG - Intergenic
1038135232 8:24778173-24778195 ATGTGGGAGATGAGAGGGAGTGG + Intergenic
1038483674 8:27918921-27918943 AGGAGGAAGATGAGAAGGAGGGG + Intronic
1038650871 8:29402142-29402164 ATGGGGCAGAAGAGAAGGAGGGG + Intergenic
1038816842 8:30912845-30912867 ATGTGGCAGATGAGGAGAGGAGG - Intergenic
1039255639 8:35715893-35715915 AGAGGGCAGGTGAGGAGTAGGGG + Intronic
1039909291 8:41811499-41811521 ATGGGGCTGATGGGCAGAAGTGG - Intronic
1042735114 8:71979096-71979118 ATTGGGCAAATGAGAGGCAGTGG - Intronic
1043483503 8:80676343-80676365 ATGGTGCAGTAGAGAAGCAGGGG + Intronic
1043978943 8:86615785-86615807 ATGGTGAAGATGAGGAGTGGCGG + Intronic
1044279117 8:90336376-90336398 ATGGTGCAGATGATACCTAGTGG + Intergenic
1044753997 8:95443070-95443092 AGGAAACAGATGAGAAGTAGAGG - Intergenic
1045844970 8:106623607-106623629 GTGGGGCAGGTGAATAGTAGTGG + Intronic
1046914846 8:119668897-119668919 CAGAGGCAGATGGGAAGTAGAGG - Intronic
1049210743 8:141385377-141385399 AAGGGGAAGATGAGAAGGGGAGG - Intergenic
1050037631 9:1454105-1454127 ATGAGGCAGATAAGAGGTGGGGG - Intergenic
1050695767 9:8277710-8277732 ATGGGGTAGAAGAGGAGAAGGGG - Intergenic
1051166398 9:14266651-14266673 ATGGGGCATATAAGAGGAAGAGG - Intronic
1051602309 9:18887818-18887840 ATGGGGCAGCCTAGAAGGAGAGG - Exonic
1057312512 9:93951161-93951183 ATGAGGCGGATGGGAAGTCGAGG - Intergenic
1057742494 9:97724127-97724149 ATGAGGCAGGTGCTAAGTAGAGG + Intergenic
1057919871 9:99088199-99088221 TTTGGGCTGATGAGAACTAGGGG + Intergenic
1060100757 9:120839204-120839226 CTGGAGCAGATGAAAAGAAGTGG + Intronic
1061860219 9:133464154-133464176 TTGGGGCACGTGAGAAGTGGCGG + Intronic
1062694645 9:137867174-137867196 CTGGGGCAGAAGAGAAGTCCCGG - Intronic
1186241189 X:7568527-7568549 ATGGTGCAGCTGAGTATTAGTGG - Intergenic
1187095702 X:16145743-16145765 ATGGGGCACATGAGATGTTTTGG - Intronic
1187111384 X:16304627-16304649 GTGGGAAAGATGAGAAGCAGAGG + Intergenic
1188600564 X:31958574-31958596 ACGTGGCAGATGAGCACTAGTGG - Intronic
1189601919 X:42635974-42635996 GTGGGACAGGTGAGAAGTACTGG - Intergenic
1193656986 X:84210633-84210655 GTGGGGCAGAGGGGTAGTAGTGG - Intergenic
1196338458 X:114567366-114567388 ATGTGGGATATGGGAAGTAGAGG + Intergenic
1196922813 X:120602154-120602176 ATGGGGTATATGAGATGTACAGG - Intronic
1197226727 X:123961754-123961776 ATGGGGCGGGGGAGAAGCAGAGG - Intronic
1197894880 X:131302160-131302182 ATGGAGAAGATGGGAAATAGGGG - Intronic
1197961906 X:132016259-132016281 ATGGAGGAGATTAGAAGCAGAGG - Intergenic
1198671356 X:139084206-139084228 ATGGGGAAGAGGAGAAGGAGTGG + Intronic
1198787278 X:140302845-140302867 GTGGGGTAGATGGGAAGCAGTGG - Intergenic
1201565618 Y:15362511-15362533 ATGTAACAGATGAGAAGCAGAGG + Intergenic