ID: 907395154

View in Genome Browser
Species Human (GRCh38)
Location 1:54184542-54184564
Sequence ACTCATTTATGGTACCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907395154_907395160 29 Left 907395154 1:54184542-54184564 CCATGCAGGTACCATAAATGAGT 0: 1
1: 1
2: 5
3: 30
4: 187
Right 907395160 1:54184594-54184616 AACACACAGTCTCAGCATCAGGG 0: 1
1: 0
2: 1
3: 21
4: 267
907395154_907395159 28 Left 907395154 1:54184542-54184564 CCATGCAGGTACCATAAATGAGT 0: 1
1: 1
2: 5
3: 30
4: 187
Right 907395159 1:54184593-54184615 TAACACACAGTCTCAGCATCAGG 0: 1
1: 0
2: 0
3: 16
4: 149
907395154_907395158 1 Left 907395154 1:54184542-54184564 CCATGCAGGTACCATAAATGAGT 0: 1
1: 1
2: 5
3: 30
4: 187
Right 907395158 1:54184566-54184588 AAGAACTGGGTGATGATTAATGG 0: 1
1: 0
2: 1
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907395154 Original CRISPR ACTCATTTATGGTACCTGCA TGG (reversed) Intronic
901284018 1:8062069-8062091 ACTGATTTTTGGTTCCTGAAGGG + Intergenic
901505674 1:9683880-9683902 ACTCATGTCTGGTACCTGGGTGG + Intronic
905940019 1:41855772-41855794 ACCCATTTATGTTATCTGCCTGG - Intronic
906139919 1:43528027-43528049 ACTCATTTCTCCTGCCTGCAAGG + Intronic
907395154 1:54184542-54184564 ACTCATTTATGGTACCTGCATGG - Intronic
907530033 1:55085793-55085815 ACTGATTTTTGGTACATGCCAGG - Intronic
909031394 1:70545408-70545430 ACTGATTTATGTTACCTCCCTGG + Intergenic
913579669 1:120213656-120213678 ACTTATTTATGCTACCCGCCAGG - Intergenic
913628505 1:120684732-120684754 ACTTATTTATGCTACCCGCCAGG + Intergenic
914561603 1:148825083-148825105 ACTTATTTATGCTACCCGCCAGG - Intronic
914611229 1:149305125-149305147 ACTTATTTATGCTACCCGCCAGG + Intergenic
914736512 1:150422498-150422520 ACTCATCTATATTACCTGCCAGG - Intronic
919066565 1:192698430-192698452 TCTCATTTATGTTATCTGCCTGG + Intergenic
919744917 1:201002673-201002695 ACTCATTTATGCCAACTGCCTGG - Intronic
919821213 1:201473373-201473395 AGTCATTGATGCTACCTGCAAGG + Intergenic
921039644 1:211417229-211417251 ACTCATTTCTGTGACCTGAAAGG + Intergenic
921660442 1:217794717-217794739 ACTCGTTTATGTTACCTGCCTGG + Intronic
922030302 1:221791053-221791075 AATCATTTATGGTCCTTGAAAGG + Intergenic
1062964887 10:1599562-1599584 ACACATTCATGGTACCAGAAAGG + Intronic
1063472503 10:6299451-6299473 ACTCAGCCATGCTACCTGCAAGG - Intergenic
1065042347 10:21710278-21710300 ACTCATTTATGTTACCTATGTGG - Intronic
1067791013 10:49287869-49287891 ACTCATTTACAGAACCTGCCAGG - Intergenic
1067931603 10:50567660-50567682 GCCAATTTATGTTACCTGCATGG + Intronic
1068206241 10:53858355-53858377 TCTCATTTAAGTTACCTGCCTGG - Intronic
1070473442 10:76808469-76808491 ACTCATTTATGTTGCCTGCCTGG - Intergenic
1071780113 10:88835083-88835105 ACTCATCTATGTTACCTGCCTGG + Intronic
1073269290 10:102248526-102248548 ACTCATTTACATTACCTGCCTGG - Intronic
1074170741 10:110933528-110933550 ACTCATTTATGTTACCTGCCTGG - Intronic
1074343613 10:112658655-112658677 ACTCATTTCTGTTCCCTGCTTGG - Intronic
1074458193 10:113613658-113613680 ACTTCTTTATGCTACCTGCCTGG - Intronic
1075070967 10:119319606-119319628 ACTCATTACGGGTACCTGGAAGG + Intronic
1079827738 11:25219318-25219340 ACTGATTTATGTTTGCTGCAGGG + Intergenic
1080524334 11:33099378-33099400 AATCATTTAGAGTACTTGCATGG - Intronic
1081987297 11:47315272-47315294 AGACATTTGTGGTACATGCAGGG + Exonic
1086743660 11:90399555-90399577 TCTCATTCATGGTAACTCCATGG - Intergenic
1091480894 12:829541-829563 ACTAATGTATGGTAGCTGTAGGG - Intronic
1093634794 12:21452554-21452576 ACTCATTTATGTTACCTGTCTGG + Intronic
1094240241 12:28213863-28213885 ACTCAATTATGGTGCCAGCTTGG + Intronic
1094587301 12:31789331-31789353 ACTGATTTGTGTTACCTGCCTGG + Intergenic
1095378741 12:41563453-41563475 GCTCATTTATGGTAAATGTATGG - Intronic
1096027590 12:48380458-48380480 ACTCAGTTATGGTACCAGCTGGG + Intergenic
1099975991 12:89545952-89545974 GCTCATTTATGGAGCCTGCTGGG - Intergenic
1100925735 12:99546167-99546189 ATTCATTTATTCTACCTGCCTGG + Intronic
1103594894 12:122018856-122018878 ACTCATTTGTGTTACCTGTCTGG - Intergenic
1103840887 12:123863349-123863371 ACTCATTTGTGCTACCTGCTGGG - Intronic
1104843737 12:131836427-131836449 ACTCATTTATGCCACCTGCTGGG - Intronic
1105270266 13:18867118-18867140 ATTTATTTATGGTACCAGAAAGG + Intergenic
1106291351 13:28365927-28365949 ACTCATTTATATTACGTGCCTGG - Intronic
1106576915 13:30983269-30983291 CCTCATTTAGGTTACCTGCCAGG - Intergenic
1106786899 13:33116239-33116261 ACACATTTTGGGTACCTGCTCGG - Intronic
1110789637 13:79573593-79573615 ACTCATTTATGGTAAGTTAAAGG + Intergenic
1111857730 13:93661073-93661095 ACTCATCTGTAGTACATGCAAGG + Intronic
1116810648 14:49536771-49536793 ACTCAATTATGTTACTTGCCTGG + Intergenic
1117426610 14:55605065-55605087 CCTCATTTATGGAACCTTCCAGG + Intronic
1118355863 14:65013186-65013208 ACTGATTTATGCTGCCTGCCTGG - Intronic
1119356629 14:74012585-74012607 ACTCATTTATATTTCCTGCCTGG - Intronic
1123903588 15:24900289-24900311 ATTCATTTGTTGTAGCTGCAGGG + Intronic
1124458147 15:29863590-29863612 ACCCATTTATGTTACCAGCCTGG + Intronic
1125739797 15:41954279-41954301 ACTTGTTTATGGGCCCTGCAAGG + Intronic
1126840358 15:52711604-52711626 ACTCATTTTTATTACCTGCCTGG + Intergenic
1127277982 15:57464121-57464143 ACTCATTTATGCTCCCTGTCTGG - Intronic
1127414595 15:58745730-58745752 ACTCATTTTTGTTACCTGCTTGG - Intronic
1128471410 15:67956782-67956804 TCTCATTTAGGATCCCTGCAGGG - Intergenic
1130872848 15:87984906-87984928 ACTTATTTACAGTACCTACATGG + Intronic
1131022603 15:89112062-89112084 AATAATGTATGGTACCTGAATGG - Intronic
1133569116 16:7024316-7024338 AATCACTTATGGTACCAGGATGG - Intronic
1135100464 16:19600711-19600733 ACTCTTTTATGTGACCTGCCTGG - Intronic
1135169132 16:20167559-20167581 AATCTTTTCTGATACCTGCATGG - Intergenic
1135252744 16:20914815-20914837 TCTCATTTATATTACCTGCCAGG + Intronic
1135257965 16:20956490-20956512 ACTCATTTATGTTACATGCCTGG + Intronic
1135485640 16:22862473-22862495 ACACATTTCTGTTACCTGCCCGG + Intronic
1135498904 16:22976725-22976747 ACTCATTTTTGTTACCCGCTTGG + Intergenic
1135742561 16:24988891-24988913 AGTCACTCATGGTACCTGCTTGG + Intronic
1135972056 16:27079342-27079364 ACTCACTCATGTTACCTGCTTGG - Intergenic
1136084084 16:27872164-27872186 ACTCATTTAAGTCACCTCCATGG + Intronic
1137385874 16:48042099-48042121 GCTCATTTATGTCACCTGCCTGG + Intergenic
1138550443 16:57744838-57744860 ACTCATTCATGTGACCTGCAGGG - Intronic
1140217853 16:73022694-73022716 GCTCATTTGTGTTACCTGCTTGG - Intronic
1140495938 16:75388470-75388492 ACTCATTTATATTACCTGCATGG - Intronic
1144237989 17:13281186-13281208 ATTCATTTAGGTTACCTGCTTGG - Intergenic
1147477389 17:40725166-40725188 ACACATTTATGGGACCTTAATGG + Intergenic
1152079820 17:78179745-78179767 ACTCATTTATTCTTCCTCCAGGG + Intronic
1154417770 18:14192853-14192875 ATTTATTTATGGTACCAGAAAGG - Intergenic
1156641981 18:39112651-39112673 AGTCATTTCTGGAACATGCAGGG + Intergenic
1158971129 18:62667653-62667675 CCTAATTTTTGGTACCTTCAAGG + Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1167499943 19:49840422-49840444 ACTCATTTATGTGACCCGCCTGG + Intergenic
926006500 2:9377184-9377206 ACTCTTTTGTGGTAATTGCAGGG + Intronic
926674222 2:15606259-15606281 ACTCAGGTATTATACCTGCAAGG + Exonic
928237325 2:29555334-29555356 ACTCATTTACTTTACCTGCTAGG + Intronic
928421938 2:31144086-31144108 ACTCATTCATGTTACTTTCATGG - Intronic
930614327 2:53577988-53578010 AGTCATTTATGTTACCTGCCTGG + Intronic
931449817 2:62359178-62359200 ACTCAATTATGGAACATTCAGGG - Intergenic
934152533 2:89161221-89161243 ACTCTTTTTTGGTGCTTGCATGG - Intergenic
934214712 2:90020694-90020716 ACTCTTTTTTGGTGCTTGCATGG + Intergenic
934928316 2:98397558-98397580 ACTTTTTTATGGAATCTGCAAGG + Exonic
935371339 2:102350176-102350198 ACTCATTACTTCTACCTGCATGG - Intronic
937357772 2:121209071-121209093 ACTCGTTTACAGTCCCTGCATGG - Intergenic
938251080 2:129816234-129816256 ACTGATATATAGGACCTGCAAGG + Intergenic
939672842 2:145034813-145034835 TCTCATTTATGGAAACTGAAGGG - Intergenic
943709706 2:191077299-191077321 ACTCATTTACCTTACCTGCAAGG + Intronic
944170973 2:196777279-196777301 ACTCATTTTTGTTACCTGCCAGG + Intronic
944312211 2:198246055-198246077 CCTGAATTATGGCACCTGCAAGG - Intronic
945191674 2:207195163-207195185 ATTCATTTATGTTACTTGCATGG - Intergenic
946827027 2:223689699-223689721 ATTCATTTATGGTACAGTCAAGG + Intergenic
1168757969 20:328914-328936 ACTCGTCTATGTTACCTGCCTGG - Exonic
1169363569 20:4972328-4972350 ACTCATTAATGGTTCCTTGAAGG - Intronic
1169611550 20:7386143-7386165 CCTCATTTCCTGTACCTGCAGGG - Intergenic
1170171064 20:13413087-13413109 ACTTATTTATTTTAACTGCATGG + Intronic
1171445440 20:25199441-25199463 ACTTATTTCTGTTACCTGCCTGG + Intronic
1171890697 20:30711121-30711143 ATTTATTTATGGTACCAGAAAGG + Intergenic
1174288960 20:49493568-49493590 TCTTATTTATGTTACCTGCATGG + Intergenic
1174875420 20:54222334-54222356 CCTCATTTATATTACCTGCGTGG + Intronic
1176855536 21:13966424-13966446 ATTTATTTATGGTACCAGAAAGG + Intergenic
1177731077 21:25027040-25027062 ACTCATTTATAGTAACAGCTAGG + Intergenic
1178129840 21:29559982-29560004 GCTCACTTATGGTATCTGCTTGG + Intronic
1179515072 21:41900622-41900644 ACTCATCTCTGGCACCTCCAAGG + Intronic
1183853876 22:40616294-40616316 ATTCATTTAAGGCACCTGCTTGG + Intronic
949177050 3:1076831-1076853 ACTCAGTAAAGGTACCTGGAAGG + Intergenic
949342921 3:3048987-3049009 ACTCATTTATGTTATCTGCCTGG - Intronic
952321105 3:32278478-32278500 ACTCATTTATGTTACCTGCTTGG + Intronic
955877416 3:63506927-63506949 CATCATTTATGCTACTTGCATGG - Intronic
957379876 3:79413403-79413425 ACTCATTTATGTTACCTGTTTGG - Intronic
961353633 3:126320096-126320118 ACCCATTTATGTTACCTCCTTGG - Intergenic
962648560 3:137464786-137464808 ACTCATTTATGGTACTCGTCTGG + Intergenic
963588307 3:147223366-147223388 AATCATTTATGATTCCTGCCTGG - Intergenic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
964693023 3:159474642-159474664 ACTCCTTTATGTTACCTGTCTGG - Intronic
964697112 3:159521567-159521589 ACTCATTTGTATTACCTGCCTGG + Intronic
966833280 3:184029398-184029420 CCTCATTTATGTTACCTGGTTGG - Intergenic
967224615 3:187279040-187279062 ACTCATTTATGTTTTCTGCCTGG - Intronic
967537889 3:190627749-190627771 ACACATTTATGATACCCACATGG + Intronic
968498757 4:933648-933670 GCTCATGTATGTTACCTGCCTGG + Intronic
970443198 4:16102501-16102523 ACCCAGTTATGGTACCTACCTGG + Intergenic
974688662 4:65266871-65266893 ACTCAGTTACAGTACCTGCTAGG + Intergenic
974688664 4:65266927-65266949 ACTCAGTTACAGTACCTGCTAGG + Intergenic
976064703 4:81171850-81171872 ACTAATTTATAGTATCTACACGG - Intronic
976398900 4:84585860-84585882 ACTCATATATGTCTCCTGCAGGG - Intronic
977956304 4:103030862-103030884 ACTCATAAATGGTACTTGCCAGG - Intronic
978630402 4:110737706-110737728 AATAATCTAGGGTACCTGCAAGG + Intergenic
979606570 4:122644860-122644882 ACTCATTTATAGTATCTGCCTGG + Intergenic
982989718 4:162256837-162256859 ACTCATTTATGTTACTAGCCTGG + Intergenic
986371054 5:7080500-7080522 AGTAATTTATGGTCCCTTCAGGG + Intergenic
986624627 5:9712157-9712179 ACTCATTTATCTTACCTGCCTGG + Intronic
988637149 5:32996764-32996786 ACTCATTTCTGTAACCTGCCTGG + Intergenic
988638050 5:33008843-33008865 GCTCATTCACTGTACCTGCAGGG - Intergenic
988806443 5:34745206-34745228 AATTATTTATGGCACCTGGAAGG + Intronic
988832576 5:35002425-35002447 CCTCATTTCTGGAACCTTCAGGG + Intronic
992363483 5:76067183-76067205 ACTCATTTATAGTTCCTCCTTGG + Intergenic
992739655 5:79760631-79760653 ACTCATTTATGAGAACAGCAAGG + Intronic
992863399 5:80934680-80934702 ACTCATCTATTTTCCCTGCAGGG - Intergenic
994876403 5:105428113-105428135 ACTCATTTATGTTACCTGCCTGG + Intergenic
995006204 5:107198818-107198840 ACTCATTAATGTTACCTGACAGG + Intergenic
995352205 5:111191850-111191872 ACACACTTATGTTACCTGCATGG + Intergenic
996999820 5:129746292-129746314 AGTCATTTAGGCTACCTACAGGG + Intergenic
999150356 5:149422548-149422570 ACACATTTGTGGGGCCTGCAGGG - Intergenic
999708029 5:154291821-154291843 TCTCATTTTTGTTACCTGCCTGG - Intronic
1000579985 5:163024668-163024690 ATTCATTTATTTTACCTGCTTGG - Intergenic
1001227786 5:169960335-169960357 GCTCATTTATGGTGCCTGAAAGG + Intronic
1001814199 5:174654278-174654300 AGGCATTTGTGTTACCTGCATGG + Intergenic
1001831639 5:174793988-174794010 TCTCTTTTATAGTCCCTGCAGGG - Intergenic
1003159776 6:3625017-3625039 ACTCAGTTATGGCTCCTGCTAGG - Intergenic
1003778611 6:9397965-9397987 ACTGATTTGTGCTACCTGCCTGG - Intergenic
1003825219 6:9944888-9944910 ACTCATTTATGTTTCTTGCCTGG + Intronic
1004762708 6:18687944-18687966 ACTTATTTAAGTTACTTGCAAGG + Intergenic
1005095956 6:22116204-22116226 ACACATTTATGGGACTTTCAAGG + Intergenic
1006940915 6:37751804-37751826 ACCCATCTATGGGACCTGCCTGG + Intergenic
1007785918 6:44279252-44279274 ACTCATGTAGGGCACCTGGAAGG + Exonic
1008189080 6:48432220-48432242 ACTAATTTACAGTACCTACAAGG + Intergenic
1009291139 6:61884122-61884144 ACTCATTTATGGAACTTTTAAGG + Intronic
1009708321 6:67284587-67284609 ACTCATTGATGGCACTTGCTGGG - Intergenic
1009990847 6:70841250-70841272 TCCCATTAATGGTTCCTGCAGGG + Intronic
1010034637 6:71310617-71310639 ACTCATTAATAGTAGCTGCTGGG + Intergenic
1010142741 6:72630319-72630341 TCTCATTTATTGTACCTGTGAGG + Intronic
1015530617 6:134217958-134217980 ACTTATTTATGTTTCCTGCCTGG + Intronic
1016608341 6:145960813-145960835 ACCCATTTATGGTACCAAAAAGG - Intronic
1017858626 6:158374777-158374799 ACTCATGAATGGTACCTCCTGGG + Intronic
1018055751 6:160050815-160050837 AGTGATTTGTGGTACCTTCATGG + Intronic
1018698179 6:166406678-166406700 ACACAGTTATTGTACCTGAAAGG + Intergenic
1023279544 7:38555470-38555492 CCTCATTGATGGTACCTGCAAGG + Intronic
1023655430 7:42414864-42414886 ACTCATTTACATTACCTGCCTGG - Intergenic
1025023991 7:55501095-55501117 ACTCTTTAATGGTGCTTGCATGG + Intronic
1025487531 7:61069788-61069810 AATCATCTATTGTACCTGAAAGG + Intergenic
1026190921 7:68126125-68126147 ACTCATTCTTGGTCCATGCATGG + Intergenic
1028256341 7:88602804-88602826 ACTCATTTATGATGCCAGAAAGG - Intergenic
1031476160 7:122224478-122224500 ATACATTTATGATACCTGCATGG + Intergenic
1033035507 7:137872596-137872618 ACTCATTCATGGTACTTACCTGG - Intergenic
1033058190 7:138079313-138079335 ACTCATTTATGCTTTCTGCCTGG - Intronic
1034463992 7:151214929-151214951 ACTCATTGATGGCATCTGCCAGG + Exonic
1037138856 8:15495881-15495903 ACTCATTTATTTTGCCTCCAGGG + Intronic
1038271817 8:26081671-26081693 ACTCATTTCTGGAAGCTGAATGG - Intergenic
1039252081 8:35677405-35677427 ACTGATTTATGTTACCTCCCTGG + Intronic
1045205810 8:100039123-100039145 CCTGATTTATGGTAACAGCAAGG - Intronic
1046173696 8:110546806-110546828 ACTTAGTTATGGTACCAGCTGGG - Intergenic
1046513888 8:115233534-115233556 ATTCATTTATAGTATCTGCCTGG - Intergenic
1047297663 8:123585589-123585611 ACTCATTCAGGTTACCTGCTGGG + Intergenic
1047963494 8:130028078-130028100 ACTCATTTATGTTTCTTGCCTGG - Intergenic
1050693855 9:8258319-8258341 ACCCATTTGTGGTAACTTCACGG - Intergenic
1052184341 9:25573225-25573247 ACCCATTTGTGGTACTTGAAGGG - Intergenic
1053657689 9:40236120-40236142 ATTTATTTATGGTACCAGAAAGG - Intronic
1053908053 9:42865400-42865422 ATTTATTTATGGTACCAGAAAGG - Intergenic
1054358164 9:64084674-64084696 ATTTATTTATGGTACCCGAAAGG - Intergenic
1054369813 9:64382392-64382414 ATTTATTTATGGTACCAGAAAGG - Intronic
1054526907 9:66140105-66140127 ATTTATTTATGGTACCAGAAAGG + Intronic
1054763005 9:69020193-69020215 ACTCATTTCTGGCACCTGCCTGG + Intergenic
1055085095 9:72305657-72305679 AAACGTTTCTGGTACCTGCAGGG - Intergenic
1055355731 9:75435342-75435364 AATATTTTATGGTACCTGCAAGG + Intergenic
1056022326 9:82452538-82452560 AGTCATTTGAGGTACCTGCATGG + Intergenic
1058966087 9:110039863-110039885 ACTCATTTATGTTATCTGTCTGG + Intronic
1060093216 9:120763263-120763285 ACTCATTTATGTTACCTGCACGG + Exonic
1061437530 9:130574860-130574882 ACTACTCTATGGTACCAGCAGGG + Intergenic
1203560313 Un_KI270744v1:48900-48922 ATTTATTTATGGTACCAGAAAGG + Intergenic
1187173288 X:16871189-16871211 AGTCATTTTTGTCACCTGCAGGG + Intergenic
1187444675 X:19350803-19350825 ACTCATTTATTCTACCTGGCTGG - Intronic
1191684651 X:63877929-63877951 ATGCATTTATGTTTCCTGCACGG - Intergenic
1192544506 X:72002241-72002263 ACTCATTTATAGTACCTTCCTGG + Intergenic
1193259045 X:79383500-79383522 ACTCATTTTTGGTACATTCAGGG - Intergenic
1193813894 X:86083241-86083263 ACTCATTTATATTACCTGCCAGG + Intergenic
1195030809 X:100926155-100926177 ATTCATTTATGATACCTGCCTGG + Intronic
1197032635 X:121836128-121836150 ACTCATTAATGAAACCTGAAAGG + Intergenic
1197529304 X:127603248-127603270 AAACATTTATGATACATGCAGGG + Intergenic
1198035362 X:132796371-132796393 ACTCAGTTATGGTGCCATCAAGG - Intronic
1198533198 X:137564714-137564736 ACTCATTTTTGTGTCCTGCAAGG - Intergenic
1198968567 X:142253599-142253621 ATTCATTTATGTTAACTACAAGG + Intergenic