ID: 907397892

View in Genome Browser
Species Human (GRCh38)
Location 1:54204751-54204773
Sequence GTGTGAATTCCTCTAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907397886_907397892 24 Left 907397886 1:54204704-54204726 CCCTGCTTGCAGCATTCAGCCAT 0: 1
1: 0
2: 0
3: 15
4: 142
Right 907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 100
907397887_907397892 23 Left 907397887 1:54204705-54204727 CCTGCTTGCAGCATTCAGCCATA 0: 1
1: 0
2: 0
3: 1
4: 115
Right 907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 100
907397885_907397892 25 Left 907397885 1:54204703-54204725 CCCCTGCTTGCAGCATTCAGCCA 0: 1
1: 0
2: 1
3: 11
4: 213
Right 907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 100
907397889_907397892 5 Left 907397889 1:54204723-54204745 CCATATTATCTCAGAGGTCTTAG No data
Right 907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907397892 Original CRISPR GTGTGAATTCCTCTAGTGGC AGG Intronic
903703939 1:25271333-25271355 TTCTGCATTCCTCTAGTGACAGG + Intronic
903723302 1:25421990-25422012 TTCTGCATTCCTCTAGTGACAGG - Intronic
905876540 1:41435404-41435426 GTGTGAATTCCATGTGTGGCTGG + Intergenic
907265939 1:53261203-53261225 GTGTGCATTCCTCTAAGTGCTGG - Intronic
907397892 1:54204751-54204773 GTGTGAATTCCTCTAGTGGCAGG + Intronic
907462758 1:54615064-54615086 ATGGGAACTCCTCTAGAGGCAGG - Intronic
912529978 1:110313184-110313206 GTTTGAATGCCTCCAATGGCAGG + Intergenic
914938862 1:152004345-152004367 GTGTGAATTCCTCAAACGGAAGG - Intergenic
915300256 1:154947615-154947637 GTGTGAATGTCTCCAGAGGCAGG - Intronic
922560260 1:226564660-226564682 GTGTGACTTCCTCTAGTGGAGGG + Intronic
1063622930 10:7666255-7666277 GTCTGAGTTCCTCGAGTTGCTGG - Intronic
1063864865 10:10353072-10353094 CTGAGAATTCCTGAAGTGGCGGG - Intergenic
1064622745 10:17230823-17230845 GCGTAAAGCCCTCTAGTGGCGGG + Intronic
1069514239 10:69065094-69065116 GTGTGAGGTCCTCTACTGGTGGG + Intergenic
1070479576 10:76869223-76869245 CTGTGCATTTCTTTAGTGGCCGG + Intergenic
1071365710 10:84898747-84898769 TGGTGAATTGCTCTAATGGCAGG - Intergenic
1072136564 10:92552497-92552519 GTGTCATTGCTTCTAGTGGCCGG - Intronic
1075146267 10:119885551-119885573 CTGAGAATTCCTCTTGTGGACGG - Intronic
1076103899 10:127804803-127804825 GTTTGAATTTGTCTAGGGGCAGG - Intergenic
1077433425 11:2527001-2527023 GTGGGAATCCCCCTAGAGGCGGG + Intronic
1077448406 11:2615936-2615958 GTGTGAATTCTTCAAGTGTTTGG + Intronic
1083159688 11:60847498-60847520 GTGTGAATGCCTCTGGAGGCGGG - Intronic
1083214767 11:61211452-61211474 GTGTGAACCCCTCTAGTGGATGG - Intronic
1083217651 11:61230281-61230303 GTGTGAACCCCTCTAGTGGATGG - Intronic
1083220646 11:61250031-61250053 GTGTGAACCTCTCTAGTGGATGG - Intronic
1085811528 11:79686885-79686907 GTGTGGGGTCCTCTAGGGGCAGG + Intergenic
1085818441 11:79766892-79766914 GCTTGAATTCCTCTAGTGACAGG + Intergenic
1085902893 11:80723050-80723072 ATGTGACTGCCTCTAGTAGCAGG - Intergenic
1089847804 11:121471981-121472003 GTCTGAATGCCTTTGGTGGCCGG + Intronic
1090732533 11:129584102-129584124 GCATGAATACCTCTAGTGTCAGG - Intergenic
1101352707 12:103947080-103947102 GTTTGAATCCCTGTAGTGTCAGG + Intronic
1104727006 12:131084402-131084424 GTGTGCATTCCTGGCGTGGCAGG + Intronic
1104916708 12:132269291-132269313 GTGTGATTTCCACGCGTGGCGGG + Intronic
1107419046 13:40229174-40229196 CTGTGAATTCCTTTAGAGGAGGG - Intergenic
1109561166 13:64052434-64052456 GTGGGAAGTGCTCTAGTGGAGGG - Intergenic
1110855282 13:80290177-80290199 GTGTTAATTCCTCGAGTGTTTGG - Intergenic
1112330278 13:98472062-98472084 GTGTGTGTCCCTCCAGTGGCTGG - Intronic
1113411738 13:110095932-110095954 GTGTGACTTATTCTAGGGGCTGG + Intergenic
1113735110 13:112672802-112672824 TTGTGAATTCCTTTGGTGGAGGG - Intronic
1117985336 14:61381169-61381191 AGGTGACTTCCCCTAGTGGCAGG + Intronic
1118059067 14:62116019-62116041 ATGTTGATTCCTCTGGTGGCTGG - Intergenic
1118884282 14:69853562-69853584 GTCTGATTTCCTCTGGAGGCAGG + Intergenic
1122343758 14:101045493-101045515 GTGTAAATTCATCCAGTGCCTGG + Intergenic
1125056222 15:35360886-35360908 CTGTTCATTCCTCCAGTGGCAGG - Intronic
1133815274 16:9192572-9192594 GCTTGGTTTCCTCTAGTGGCAGG + Intergenic
1133967237 16:10540207-10540229 GTTTAAATTCCTCTAAGGGCTGG + Intronic
1139110491 16:63885173-63885195 GTGTGAAGGCTTCCAGTGGCAGG - Intergenic
1141061837 16:80880389-80880411 ATGAGAATGCCTTTAGTGGCTGG - Intergenic
1141450034 16:84093147-84093169 GTATGAATTCCTCAAGTTTCAGG + Intronic
1143391668 17:6562356-6562378 GTGTGATTTCCTGCAGGGGCAGG + Intergenic
1149244570 17:54690398-54690420 GTTTGTATTCCTCTTGTGGTTGG - Intergenic
1156133473 18:34006825-34006847 GTGTGAATACCTCGAAGGGCTGG + Intronic
1156418911 18:36929455-36929477 CTTTGAATTTCTCTAGTGGTGGG + Intronic
1156475616 18:37403627-37403649 GTGTGCAGTCCTCTAGAGGTGGG + Intronic
1157611042 18:48955679-48955701 CTGGGAATTCCTCTACTGCCAGG - Intergenic
1157994102 18:52534424-52534446 GTGTGAATTAATCTAATGACAGG - Intronic
1165048895 19:33128715-33128737 GTGTGAATTCTTTGAGTGTCTGG + Intronic
1165614316 19:37185599-37185621 GTGGGAAAGCCTTTAGTGGCAGG - Exonic
928914815 2:36459503-36459525 CTGTGAATTCCTCTAGTGCAGGG - Intronic
936011378 2:108927389-108927411 GCCTGAATTCTTCTAGAGGCAGG + Intronic
936670805 2:114653717-114653739 CTGAGAATTCCTCTAGCGTCAGG - Intronic
943870155 2:192984694-192984716 ATGTGAATTTCTGTAGGGGCAGG - Intergenic
945175495 2:207039363-207039385 GTGTTAACTCCTCCAATGGCAGG + Intergenic
946160677 2:217834234-217834256 CTGTGCATTCCCCTAGGGGCTGG - Intronic
948852801 2:240716653-240716675 GTGTGAGTTCCTCTGGTGGGAGG - Exonic
1172799930 20:37568566-37568588 GTTTGAATTCCTTCAGTGGCAGG - Intergenic
1182571606 22:31243391-31243413 GTGTGAAGCCCTCTATTGGCTGG - Intronic
1184499395 22:44862684-44862706 TTCTGAATTCATCTAATGGCTGG - Exonic
949151860 3:778727-778749 ATTTGAATTCCTCTAGTGGCAGG + Intergenic
951896810 3:27617286-27617308 GTGTTAACTCATCTAGTGCCTGG - Intergenic
954848528 3:53580583-53580605 TTGTGACTTCCTCTAGATGCAGG + Intronic
956894062 3:73641638-73641660 CTGTGAATTCAGCTAGTGGAAGG - Intergenic
967929048 3:194677296-194677318 GCTTGAATGCCTCTGGTGGCAGG - Intergenic
971379265 4:26081765-26081787 GTCTACATTCTTCTAGTGGCAGG - Intergenic
978423542 4:108559338-108559360 GTGTGAACTCCTGGAGTGTCAGG + Intergenic
978568419 4:110110182-110110204 GTGTTATTTCCTCTAGTCTCTGG - Intronic
979670999 4:123360070-123360092 GTGTGAATTGAGGTAGTGGCAGG + Intergenic
979690771 4:123555905-123555927 GTGTGATTCCATCTAGTGCCAGG - Intergenic
983802306 4:171947839-171947861 GTGAGACTTCCTCTAGTTTCAGG - Intronic
993320605 5:86464393-86464415 AGGTGAATTCCTCTAGTTCCTGG - Intergenic
999093897 5:148961063-148961085 GTGTCACTTGCTCTGGTGGCAGG - Intronic
999606020 5:153317130-153317152 TTGTGAATTCCTCCAGCGACGGG - Intergenic
1000977895 5:167784680-167784702 GTGTGAATTCTTATAGTCACTGG - Intronic
1005094395 6:22097909-22097931 GTGTGACTGACTCTAGTTGCAGG - Intergenic
1005224474 6:23625825-23625847 TTGAGAAATCATCTAGTGGCTGG - Intergenic
1013500757 6:110748801-110748823 GTATGAATTCCTCTACTTGGAGG - Intronic
1016283611 6:142448214-142448236 GTGTGAATAACCCAAGTGGCTGG + Intergenic
1018163364 6:161069746-161069768 GTGTGAAATACTCTGATGGCAGG + Intronic
1022308587 7:29174024-29174046 GTGTGAACTCCGCTTGTGTCTGG - Intronic
1028753693 7:94410737-94410759 CTATGAATTCCTCTAGGGGTTGG + Intronic
1032676032 7:134130291-134130313 TTGTGAATTCCTCTGGGGGGGGG - Intronic
1032755756 7:134889273-134889295 ATGTGACTTCCTCTAGAAGCTGG - Intronic
1036362087 8:8085188-8085210 ATGTGATTTACTCTAGTGGAAGG + Intergenic
1040791353 8:51233660-51233682 GTGTGCTTACCTCTTGTGGCAGG + Intergenic
1044801397 8:95960924-95960946 TTGAGAATGCCTCAAGTGGCAGG + Intergenic
1045495109 8:102701498-102701520 GTTTGAATTCCTCCAGAGACGGG - Intergenic
1045909018 8:107383567-107383589 GTCTGAATTACTTTAGAGGCAGG + Intronic
1047373035 8:124271930-124271952 CTGTGAATTCCTTTTGTGGGAGG - Intergenic
1047437626 8:124847840-124847862 TTGTGAAATCTTCTAGAGGCAGG + Intergenic
1049293172 8:141814600-141814622 TTGGGCATTCCTCCAGTGGCCGG + Intergenic
1050210716 9:3252642-3252664 GTCTGGATGACTCTAGTGGCTGG + Intronic
1053796784 9:41733876-41733898 GTTTGAAAACCTCTATTGGCCGG + Intergenic
1054185197 9:61945951-61945973 GTTTGAAAACCTCTATTGGCCGG + Intergenic
1054468152 9:65512087-65512109 GTTTGAAAACCTCTATTGGCCGG - Intergenic
1054653312 9:67642545-67642567 GTTTGAAAACCTCTATTGGCCGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1186342242 X:8657270-8657292 CTGTGAACTCCTCTTTTGGCTGG + Intronic
1187451526 X:19401141-19401163 GTGTGAGTTACTCTACTAGCAGG + Intronic
1187747392 X:22424346-22424368 CTGTCATTTCCTCTACTGGCAGG - Intergenic
1196983167 X:121238156-121238178 GTTTGATTTGCTCTAATGGCAGG + Intergenic
1197723228 X:129759093-129759115 GTGTGCTTTCCACAAGTGGCAGG - Intronic