ID: 907397919

View in Genome Browser
Species Human (GRCh38)
Location 1:54205007-54205029
Sequence TTACCTCAAAGGTGTAAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907397917_907397919 -1 Left 907397917 1:54204985-54205007 CCTTCTTTATTTTTGTGGCTAAT 0: 1
1: 0
2: 2
3: 52
4: 575
Right 907397919 1:54205007-54205029 TTACCTCAAAGGTGTAAAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 116
907397915_907397919 16 Left 907397915 1:54204968-54204990 CCTGAATCTTTTTCTTTCCTTCT 0: 1
1: 2
2: 15
3: 228
4: 1944
Right 907397919 1:54205007-54205029 TTACCTCAAAGGTGTAAAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907397919 Original CRISPR TTACCTCAAAGGTGTAAAGC AGG Exonic
907397919 1:54205007-54205029 TTACCTCAAAGGTGTAAAGCAGG + Exonic
907442133 1:54485553-54485575 TTACCACAAAGCTATCAAGCTGG - Intergenic
907792609 1:57682110-57682132 TTGCCACAAAGGTGTAAACATGG + Intronic
911180541 1:94856376-94856398 TACCCACAAAGGGGTAAAGCTGG + Intronic
911665428 1:100546199-100546221 TTACCTCCAAGGGGTAAACATGG + Intergenic
913101037 1:115566141-115566163 TTTCCTGAACGGTGTAAAGCTGG - Intergenic
916458021 1:164991286-164991308 TTAGGTCAAAGGTTTCAAGCAGG - Intergenic
917787869 1:178478458-178478480 TTTCCTCACAGGTGTAACTCAGG - Intronic
918281157 1:183007479-183007501 ATAACTCAAATGTATAAAGCGGG - Intergenic
923227414 1:231951189-231951211 GTTACTCAAAGGTGAAAAGCTGG + Intronic
923240902 1:232084615-232084637 TTACCACACAGGTTTAAAGATGG + Intergenic
1063131029 10:3176979-3177001 CTCCCTCAAAGGTGGAAATCAGG - Intergenic
1063132206 10:3188068-3188090 GTACCTCCAAGATGTAAAGCTGG + Intergenic
1067760959 10:49046580-49046602 TTACAGAAAAGTTGTAAAGCTGG - Intronic
1069219188 10:65862111-65862133 TTCTCTCAAAGCTGTAAATCAGG - Intergenic
1072521069 10:96230565-96230587 CTACCTCAAAGGTTTAAATGAGG + Intronic
1072851804 10:98902875-98902897 TTTCCTCAAATGGGTAAACCAGG + Intronic
1073267687 10:102238041-102238063 TTAACTGAAAGGTGTAAAAAAGG + Intronic
1074065839 10:110012891-110012913 TTACCTTAAAGATATAAACCAGG - Intronic
1079341321 11:19613796-19613818 TTAGCTCAAAGGTTTCAAGGAGG + Intronic
1080913911 11:36635464-36635486 TTACTTCAAAGGTAAAAAGCAGG - Intronic
1084927664 11:72526668-72526690 TTACTTAACAGGTGCAAAGCAGG - Intergenic
1087503457 11:98990184-98990206 TTATCTCAAGGATGTAAGGCTGG - Intergenic
1088117771 11:106332318-106332340 TTACTGTAAAGCTGTAAAGCTGG - Intergenic
1090791437 11:130093373-130093395 TTACCTCAAAGGAGAGAAGAGGG + Intronic
1092184529 12:6469138-6469160 TTCCCTCTAAGGTGCAAAGGAGG + Intronic
1094280191 12:28728588-28728610 TTCCCTGAAAGGTTAAAAGCTGG - Intergenic
1094848635 12:34372535-34372557 TTCCCCCACAGGTGTGAAGCAGG + Intergenic
1099353091 12:81597948-81597970 TTACTTGAAAAGTGTAAAACCGG + Intronic
1101325340 12:103710567-103710589 TTGGCTCAAAGGTTTAGAGCAGG + Intronic
1103720818 12:122974515-122974537 CTAGCTCAAAGGTTTAATGCTGG + Intronic
1104635402 12:130435342-130435364 TTACCTCAAAGGTTAAAAAGAGG - Intronic
1105031829 12:132889427-132889449 CTCCCTAAAAGGTGTAAAACCGG + Intronic
1105860689 13:24409420-24409442 TTAGCTCCAAGGTGGAAAGAAGG + Intergenic
1107523787 13:41210109-41210131 TTACCTCAATGGAATAAAACTGG - Intergenic
1109035976 13:57260725-57260747 TTATTTCAAAGGGATAAAGCTGG - Intergenic
1110027760 13:70563266-70563288 TTACCTCAAATGTGAAAGGTGGG + Intergenic
1110027774 13:70563485-70563507 TTACCTCAAATGTGAAAGGTGGG + Intergenic
1111661784 13:91221009-91221031 TTACATCCAAGGAGCAAAGCAGG + Intergenic
1116112008 14:40596987-40597009 TTACCTCAATGGAATAAAGGAGG + Intergenic
1116147639 14:41096003-41096025 TTACTTCAAAAGTGTAAATTTGG + Intergenic
1116155021 14:41193018-41193040 TTATCTCAAGGGTGTAAGGAAGG + Intergenic
1121465483 14:94112794-94112816 TTACCTCCAAGTTGCAAAACAGG - Intronic
1126636228 15:50782550-50782572 TTAAGTCAAAGGAATAAAGCTGG + Intergenic
1128721249 15:69950867-69950889 TTATATTAGAGGTGTAAAGCAGG - Intergenic
1130119574 15:81035907-81035929 TTACTTGAAAGGCTTAAAGCTGG - Intronic
1134127191 16:11624214-11624236 TTCCCTCAGAGGGGTAAAGAGGG + Intronic
1134569073 16:15275937-15275959 TTACCTTGTAGTTGTAAAGCTGG - Intergenic
1134733364 16:16480411-16480433 TTACCTTGTAGTTGTAAAGCTGG + Intergenic
1134934133 16:18231865-18231887 TTACCTTGTAGTTGTAAAGCTGG - Intergenic
1141082705 16:81066707-81066729 TTACGTCAAATGTGTAAGTCAGG - Intronic
1144152232 17:12460164-12460186 TTACCTTAAAGGTTTAATTCAGG - Intergenic
1144342742 17:14323666-14323688 TGACCACAAAGCTATAAAGCTGG - Intronic
1149796914 17:59529219-59529241 TTTCCTCAGAGGTGTAGAGAAGG - Intergenic
1152613564 17:81327930-81327952 TTCCCTCAAAGGTTAAAATCTGG - Intronic
1155937188 18:31766176-31766198 TAACCTCAATTTTGTAAAGCAGG + Intergenic
1165283110 19:34814870-34814892 TCATCTCAAAGGTTCAAAGCAGG - Intergenic
1167469517 19:49667588-49667610 TTTCCTCATAGGTGTGAACCTGG + Intronic
926017993 2:9471283-9471305 TTTCCTCAAATATATAAAGCCGG + Intronic
928658139 2:33474154-33474176 CTACATCATAAGTGTAAAGCAGG - Intronic
931185891 2:59951084-59951106 TTACCTTAATGGTGTAAGTCGGG - Intergenic
931869206 2:66440995-66441017 TTGCCTGAAAGGTGTAAGGAAGG + Intronic
931892685 2:66691705-66691727 TTACCCCAAAGCCGCAAAGCAGG - Intergenic
935395720 2:102606536-102606558 TTACATCACAAGTGTAAACCAGG - Intergenic
939348070 2:140994096-140994118 CTACCTCACATATGTAAAGCTGG - Exonic
942046233 2:172100933-172100955 TTTCCTCAAAGGTCAAAATCTGG - Exonic
943753705 2:191536668-191536690 ACTCCTCAAAGGTGGAAAGCAGG + Intergenic
1169233800 20:3912284-3912306 GTACCTTAAAGGTGTATATCAGG + Intronic
1169521703 20:6380521-6380543 TTACCTAAGAGATGGAAAGCCGG - Intergenic
1173216072 20:41085664-41085686 TTACCTCAAAGCTGGAAAGCTGG - Intronic
949316554 3:2762723-2762745 ATCCCTCAAAGATGTAAAGATGG - Intronic
950935564 3:16835512-16835534 TAACTTCATAGGTGTCAAGCAGG - Intronic
955873043 3:63460129-63460151 TTTACTCAAATGTGTTAAGCAGG - Intronic
958010864 3:87877759-87877781 TGAGCTCAAATGTGTAAAGCAGG + Intergenic
960121803 3:113954510-113954532 ATATCTACAAGGTGTAAAGCTGG - Intronic
962482229 3:135807749-135807771 TTTCCCCAAAGCTGGAAAGCTGG - Intergenic
970507397 4:16745237-16745259 TTACCTCTGAGGTGTAGAGGAGG - Intronic
976215236 4:82709925-82709947 CTACCTCATAGGAGTAAAACAGG - Intronic
979163887 4:117500691-117500713 AGACCTCCAGGGTGTAAAGCTGG + Intergenic
981364175 4:143882746-143882768 TGAACTGAAAGGTGTAAAGAAGG - Intronic
981385233 4:144122834-144122856 TGAACTGAAAGGTGTAAAGAAGG - Intronic
986734903 5:10661413-10661435 TTACCGCAAATGTGGATAGCTGG + Intergenic
986882959 5:12198163-12198185 TTACTGCAAAGGTGAAAAGGGGG - Intergenic
987463520 5:18244549-18244571 TAAGCTCAAAGATGTAAAGAGGG + Intergenic
996336950 5:122394551-122394573 TAAGCACAAAGGTTTAAAGCAGG + Intronic
998982759 5:147722401-147722423 GTACCTCACACGTGCAAAGCAGG - Intronic
999250874 5:150181599-150181621 TTTCAGCAAAGGTGTAAAGGAGG - Intronic
999683749 5:154083987-154084009 TTCCCTCGAAGGAGTAAACCAGG + Intronic
1001699338 5:173695532-173695554 CTACCTCACAGGTGGAAACCTGG - Intergenic
1003402584 6:5803132-5803154 TTAGCCCAAAGCTGTAAAGAAGG - Intergenic
1003840710 6:10116407-10116429 TTATCCCAAGGGTCTAAAGCAGG + Intronic
1009783763 6:68303793-68303815 TTACCACAATGGAGTAAAACTGG + Intergenic
1012612937 6:101237689-101237711 TTTCCTCAAATGTGAAAAGAAGG - Intergenic
1013096321 6:106948507-106948529 ATACCTGAAAGCTGGAAAGCTGG + Intergenic
1013943472 6:115693781-115693803 TTAGTTCAAAGGTGTCAGGCTGG - Intergenic
1014366122 6:120544406-120544428 TTAAGTCAAAGGTTCAAAGCTGG + Intergenic
1016114716 6:140265902-140265924 TTACCTCAGTAATGTAAAGCTGG - Intergenic
1016635979 6:146290784-146290806 TCACCTCAATCATGTAAAGCAGG - Intronic
1017046934 6:150355891-150355913 TTACATCACAGGTGTCTAGCTGG + Intergenic
1023191321 7:37585930-37585952 TCACTTCAAATGGGTAAAGCAGG - Intergenic
1024333830 7:48183430-48183452 TGACATAAAAGGTGTAAAACTGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1030581884 7:111366963-111366985 TTACATCAAAGTTGCAAAGATGG - Intronic
1030617089 7:111749172-111749194 TTACCTGAATGGTGGAAAACGGG + Intronic
1035890958 8:3342133-3342155 TTATCACAAAGGTGAAAAACTGG + Intronic
1037280020 8:17229978-17230000 TTTCCTGAAGGGTGTAAAGCTGG + Exonic
1042822504 8:72945919-72945941 TTACTTCAAAGGTAAATAGCTGG + Intergenic
1043117765 8:76280940-76280962 TTAACTTAAAGGTGTAAAAAAGG - Intergenic
1044145360 8:88706665-88706687 TTAGCTCAAAGGTATTAATCAGG - Intergenic
1044257788 8:90086118-90086140 TTACCTCAAATCTGTAGATCTGG - Intronic
1047257668 8:123227927-123227949 TTACATCAAAGGGGTAACGAAGG - Intronic
1049013610 8:139904673-139904695 TTACCTCAGACCTGCAAAGCAGG - Intronic
1049045261 8:140145598-140145620 TTATCTCAGAGGTGCAAAGATGG - Intronic
1057680764 9:97181818-97181840 TTACCACAAAAGTTTATAGCTGG + Intergenic
1057746108 9:97752611-97752633 TTAACTCAAAGGTGAGAAGGGGG + Intergenic
1059418584 9:114177096-114177118 TTACCTCGAAGGAGTAAATGAGG - Intronic
1060024631 9:120160880-120160902 TTACCATAGAGGTGTAAAGTCGG + Intergenic
1189795364 X:44641094-44641116 TGACCTCCAATGTGTATAGCTGG - Intergenic
1192402098 X:70846177-70846199 TTATCTCCTAAGTGTAAAGCCGG - Intronic
1194178274 X:90680344-90680366 TTTCCTCAAAATTGTAAACCAGG - Intergenic
1195866827 X:109441429-109441451 TTACCTCAGAGGTCCAAAGTGGG - Exonic
1196624669 X:117864671-117864693 TTACCTCACAGTTCTAAGGCTGG + Intergenic
1196903890 X:120412823-120412845 TTACCTCAAAGAGGTAAAGAGGG - Intergenic
1200524937 Y:4262504-4262526 TTTCCTCAAAATTGTAAACCAGG - Intergenic