ID: 907399708

View in Genome Browser
Species Human (GRCh38)
Location 1:54217375-54217397
Sequence CTGAAGACACAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 573
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 518}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907399708_907399719 21 Left 907399708 1:54217375-54217397 CCCTCCTGACTCTGTGTCTTCAG 0: 1
1: 1
2: 2
3: 51
4: 518
Right 907399719 1:54217419-54217441 CCTTCCAGGATACTGACTCAGGG No data
907399708_907399712 7 Left 907399708 1:54217375-54217397 CCCTCCTGACTCTGTGTCTTCAG 0: 1
1: 1
2: 2
3: 51
4: 518
Right 907399712 1:54217405-54217427 TCCCTCAGCCTCTCCCTTCCAGG No data
907399708_907399721 25 Left 907399708 1:54217375-54217397 CCCTCCTGACTCTGTGTCTTCAG 0: 1
1: 1
2: 2
3: 51
4: 518
Right 907399721 1:54217423-54217445 CCAGGATACTGACTCAGGGCTGG No data
907399708_907399722 26 Left 907399708 1:54217375-54217397 CCCTCCTGACTCTGTGTCTTCAG 0: 1
1: 1
2: 2
3: 51
4: 518
Right 907399722 1:54217424-54217446 CAGGATACTGACTCAGGGCTGGG No data
907399708_907399717 20 Left 907399708 1:54217375-54217397 CCCTCCTGACTCTGTGTCTTCAG 0: 1
1: 1
2: 2
3: 51
4: 518
Right 907399717 1:54217418-54217440 CCCTTCCAGGATACTGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907399708 Original CRISPR CTGAAGACACAGAGTCAGGA GGG (reversed) Intronic
900602174 1:3507629-3507651 CTGGAGACAGGGAGGCAGGAAGG + Intronic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
901132961 1:6974066-6974088 CTGAAGACAGACAGACAGGCTGG + Intronic
901222248 1:7589887-7589909 CTGAAGCCACACAGCCAGAAGGG - Intronic
902409780 1:16206084-16206106 CTGAGGAGTCAGAGCCAGGATGG + Intronic
902452420 1:16505511-16505533 CTGAAGACACCCAGGCAGGAAGG - Intergenic
902500572 1:16908351-16908373 CTGAAGACACCCAGGCAGGGAGG + Intronic
902650222 1:17832566-17832588 CTGAAGACACAGATTCATCTTGG + Intergenic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
906445751 1:45896586-45896608 CTTAAGACCCACAGTCAGAAAGG + Intronic
906674082 1:47680756-47680778 CTGAAGACACAGGGAGAAGACGG - Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
908538723 1:65103013-65103035 CTGAAGAAACACAGCCAGGCTGG - Intergenic
908918260 1:69158043-69158065 CAGAAGAAACAGCTTCAGGAAGG - Intergenic
910132205 1:83921593-83921615 CTGAAGATACAGAGACAAAATGG + Intronic
912448045 1:109752193-109752215 CCTAAGAAACAGAGTCAGGATGG + Exonic
912518602 1:110230705-110230727 ATGAAGCCAGAGAGCCAGGAGGG - Intronic
912995730 1:114530909-114530931 CAGAAAACACAGAGTTAGCAGGG - Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914095714 1:144543091-144543113 CTGAAGACACCCAGGCAGGAAGG - Intergenic
914302807 1:146390878-146390900 CTGAAGACACCCAGGCAGGGAGG + Intergenic
914464381 1:147913077-147913099 TGGAATACCCAGAGTCAGGAGGG - Intergenic
914517010 1:148382805-148382827 CTGAAGACACCCAGGCAGGGAGG - Intergenic
915883573 1:159700094-159700116 CTGAAAACACAGGGCCATGAGGG + Intergenic
916016000 1:160750402-160750424 CTGAAGAGAGAGAGACAAGAAGG + Exonic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916553951 1:165876877-165876899 GTGAAGACACGGAGACATGAGGG - Intronic
917956284 1:180102052-180102074 CTTAAGACCCACAGTCAGAAAGG + Intronic
918239005 1:182605417-182605439 CTGAAGACCCAGCTGCAGGAAGG + Intergenic
919715313 1:200769863-200769885 CTTAAGACCCACAGTCAGAAAGG + Intronic
921347619 1:214203234-214203256 CTGACGACCAAGAGTCAGGCAGG + Intergenic
921968576 1:221119898-221119920 CTGAAGACACAGGGAGAAGATGG + Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
1063570839 10:7213371-7213393 CTGAAATCACAGAGCCAGGGAGG + Intronic
1063627227 10:7701537-7701559 CTGAAGACAGAGTATCAGCATGG + Intergenic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1063972594 10:11391762-11391784 GTGAGGACACAGAGACGGGACGG - Intergenic
1064056005 10:12097979-12098001 CTGAAGACACATGTTCAGGTGGG + Exonic
1064267054 10:13833582-13833604 CTGAAGCCACACAGTCAGTAAGG - Intronic
1064655458 10:17551438-17551460 CTTAAGACCCACAGTCAGAAGGG - Intergenic
1066022243 10:31315667-31315689 CTGCAGTCATTGAGTCAGGAAGG - Intergenic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1067085486 10:43235840-43235862 CTGCAGCCACACAGGCAGGACGG + Intronic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1067902081 10:50252716-50252738 CTGCAGACCCAGGATCAGGATGG + Intergenic
1068131085 10:52896193-52896215 CTAAAGCCACGGATTCAGGAAGG + Intergenic
1069761416 10:70814226-70814248 CCAAAGACACACAGGCAGGATGG - Intergenic
1069843683 10:71355922-71355944 CTGAAGCCTCAGAGACAGGGAGG - Intronic
1069979917 10:72245266-72245288 CTGTGGCCACAGAGTCAGCAGGG - Intergenic
1070035613 10:72720293-72720315 CTGAAGAAATAAAGACAGGAAGG + Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1071873073 10:89816172-89816194 GTGAGGACACAGCCTCAGGAAGG + Intergenic
1072276005 10:93824223-93824245 ATGAAGACAAAGGGCCAGGAGGG + Intergenic
1073293569 10:102425199-102425221 CTGAAGGGACACAGACAGGATGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1075115181 10:119620178-119620200 CTGAAGACAAAGTCTCAGGCAGG - Intergenic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075608628 10:123834280-123834302 CAGAGGAGACAGTGTCAGGAGGG + Intronic
1075646931 10:124102800-124102822 CTGAAGCCACAGGGGAAGGATGG + Intergenic
1075667201 10:124239903-124239925 AGGAAGACACAGGGTCGGGAAGG - Intergenic
1075673492 10:124280398-124280420 CTGAGGCCACACAGCCAGGAAGG + Intergenic
1075984346 10:126770679-126770701 CAGAAGACACAGAGACATGTAGG - Intergenic
1075996236 10:126878477-126878499 GTGCAGACAGAGAGCCAGGATGG - Intergenic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1076201748 10:128564427-128564449 GTGAAGACACAGGGACAAGATGG + Intergenic
1076352432 10:129826186-129826208 CTGAGGACAAAGACTCAGGAGGG + Intergenic
1076671314 10:132122365-132122387 CAGAAGACCCACAGTCAGGCTGG - Intronic
1076800709 10:132826746-132826768 CTGGAGCCACAGAGCCAGGCAGG + Intronic
1076896653 10:133316539-133316561 CTTAGGACACAGAGATAGGAAGG + Intronic
1078260574 11:9703407-9703429 CTGAAGGCTCTGAGGCAGGAAGG - Intronic
1078440303 11:11359543-11359565 CAGAGTCCACAGAGTCAGGAAGG - Intronic
1078512267 11:11994332-11994354 CTGAAGAAACCGAGTCACAAAGG + Intronic
1078659480 11:13275762-13275784 CAGATGACACAAAGCCAGGAGGG - Intergenic
1079075573 11:17383583-17383605 ATGAGGACACAGGGTCAGAAAGG - Intergenic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081574919 11:44313065-44313087 CTCAAGGCACAGGCTCAGGAAGG - Intergenic
1081654549 11:44848855-44848877 CTGAAGAGACAGGGCCAGGGGGG - Intronic
1082565142 11:54667963-54667985 CTGAAGAATCTTAGTCAGGAAGG + Intergenic
1082616609 11:55368640-55368662 CTTAAGACTCAGAGTTTGGAAGG + Exonic
1082626391 11:55491870-55491892 CTTAAGACTCAGAGTTTGGAAGG + Intergenic
1083276689 11:61600877-61600899 CTGAAGCCCCAGACTCAGGTTGG - Intergenic
1083859492 11:65412258-65412280 CTGAAGACCCAGACACAGGGAGG - Exonic
1083878150 11:65535544-65535566 CCGAAGTCACACAGTCAGGAGGG + Intronic
1084909067 11:72373015-72373037 CTGAAGACACAGAGATGGGGAGG + Intronic
1085183349 11:74554690-74554712 CTGAAGACAAAGGGTCATGGAGG + Intronic
1085468198 11:76738339-76738361 CTGAAAAAGCAGTGTCAGGAAGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1086097065 11:83061023-83061045 CTGAAGACCCAGAGACTGGGGGG - Intronic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1087694827 11:101364669-101364691 CTGAACACATAGACACAGGAAGG - Intergenic
1087905214 11:103688122-103688144 TTGAAGACACAAAGTTAGAAAGG + Intergenic
1088577456 11:111285691-111285713 CGGCAGACACAGGGTCAGGCTGG - Exonic
1088715245 11:112543337-112543359 CTTAAATCAGAGAGTCAGGAAGG - Intergenic
1088864184 11:113831138-113831160 CTGAAGACACAAAGACAAGAAGG + Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1090869853 11:130734491-130734513 TTGAAGAGACAGAGTGGGGAGGG + Intergenic
1091198020 11:133748275-133748297 CTGAAGAAACTGAGTCTGAAAGG + Intergenic
1091304584 11:134529510-134529532 CTAAGGACTCAGAGTAAGGAGGG - Intergenic
1092950741 12:13500683-13500705 CCAAAGGCACAGAGTCAGCAGGG - Intergenic
1093971413 12:25379495-25379517 CTGGAGACAAAGAGACAAGATGG - Intergenic
1094597577 12:31879211-31879233 CTGAAGACTTAAAGTCAGGCCGG + Intergenic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095174136 12:39071264-39071286 CTGAAAAGACAGATCCAGGATGG - Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096004906 12:48161637-48161659 CTGGACACCCAGATTCAGGAGGG + Intronic
1096828409 12:54296550-54296572 ATGAAGATACAGGGGCAGGAGGG - Intronic
1096841101 12:54379531-54379553 CTGAAGACAGACTGTCAGCAGGG - Intronic
1096910772 12:54981665-54981687 CTGAAGAGAGAGAGAAAGGAGGG + Intronic
1097971278 12:65635719-65635741 CTTAAGGCATAGAGTTAGGATGG + Intergenic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098477499 12:70921659-70921681 ATAAAGACACAGAGGCAGAAAGG - Intergenic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1101071491 12:101080591-101080613 CTGAAGACACAGGGAGAAGATGG - Intronic
1101544767 12:105702150-105702172 CTGAAGACACATAGTAAATAGGG + Intergenic
1102195717 12:111023877-111023899 CTGAAGAAACAGGTTCAGGCAGG + Intergenic
1102534357 12:113569780-113569802 CTGAGGACATGGAGTCAAGAGGG + Intergenic
1103338273 12:120206537-120206559 ATGAAGACAAAGAGACTGGAAGG - Intergenic
1103448182 12:121008567-121008589 CTGAAGCCAGAGAGTCACAAAGG + Intronic
1103480856 12:121248902-121248924 ATGAAGACGGAGAGACAGGACGG + Intronic
1103620397 12:122183719-122183741 CTGGAGACAGGGAGGCAGGATGG - Intronic
1103901937 12:124307879-124307901 CAGAAGCCAGAGAGGCAGGAAGG - Intronic
1104271073 12:127282747-127282769 CTGGAGACACACAGCCAGGGAGG + Intergenic
1104366753 12:128184955-128184977 CTGAAGTCAAAGTGTCAGTAAGG - Intergenic
1104795029 12:131511331-131511353 CAGGAGACACAGACTCAGAAAGG + Intergenic
1105572818 13:21620177-21620199 CTGAAGTCAAAGTGTCAGCAGGG + Intergenic
1105823997 13:24105874-24105896 GTGAAGACACAGGGTGAAGACGG + Intronic
1105893603 13:24699645-24699667 ATGCAGACAAAGTGTCAGGAAGG + Intronic
1106627019 13:31431139-31431161 GTGAAGACATAGAGTGTGGAAGG - Intergenic
1106806794 13:33316962-33316984 CTGAAGACAAAATTTCAGGAAGG - Intronic
1107555437 13:41513480-41513502 CTGAGGACACAGCATGAGGACGG + Intergenic
1107736549 13:43405141-43405163 CTGAAGAGACAGTTTCAGGCAGG + Intronic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1109006598 13:56885464-56885486 CTGAACACACAGCTTCGGGAGGG + Intergenic
1109062757 13:57639131-57639153 CAGAAGGCACAGAGTAAGAAAGG - Intronic
1109459629 13:62638792-62638814 CTTAAGACCCACAGTCAGAAAGG + Intergenic
1112369750 13:98784395-98784417 GTGAAGACACAGGGGGAGGATGG - Intergenic
1112431355 13:99353455-99353477 ATGAAGACACCAAGGCAGGATGG - Intronic
1113077120 13:106477948-106477970 GTGAAGACACAGGGAGAGGACGG - Intergenic
1113376441 13:109768746-109768768 CAGAAGATACAGAATCAGGCAGG + Intronic
1113580686 13:111426501-111426523 CTGAAGTCACAGAGGCAGTGAGG - Intergenic
1113723203 13:112577052-112577074 GACAAGACACAGAATCAGGAAGG + Intronic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1114501234 14:23170435-23170457 CGAAAGAAACAGAGACAGGAAGG - Intronic
1117755669 14:58971783-58971805 CTGAAGAGACAGAGACACGGGGG - Intergenic
1117847351 14:59925200-59925222 ACGAAGACACTGAGTCAAGAAGG - Intronic
1118072293 14:62258295-62258317 CTGAAGACACAGAAATAGGTGGG + Intergenic
1119483728 14:74975222-74975244 CTGAAGAGATAGAGGCTGGAGGG + Intergenic
1119531141 14:75362184-75362206 CTGGAGACACACTCTCAGGAAGG - Intergenic
1119726605 14:76925212-76925234 ATGAAGACACAGCCTCAGAAAGG - Intergenic
1120844362 14:89112947-89112969 CTTAAGACACAGAGTGTGGTGGG - Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122166349 14:99827253-99827275 CTGAAGACACAGGGAGAAGATGG + Intronic
1122296115 14:100706572-100706594 GTGGAGACACAGTGTCAGTAGGG + Intergenic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122622642 14:103068564-103068586 CTGAAGACACAGGGCAAGGGTGG + Intergenic
1122862147 14:104587503-104587525 GTGAAGAGACGGGGTCAGGAGGG + Intronic
1122935390 14:104953612-104953634 CAGAAGACACAGAGCAGGGAAGG - Exonic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1124151052 15:27178607-27178629 CTGAAGACCCAGAGACACGGGGG + Intronic
1124339517 15:28881070-28881092 TGGAAGACACAGAGACAGCATGG - Intergenic
1125511060 15:40292542-40292564 CTGAAGTCACACAGCCAGGATGG - Intronic
1125796906 15:42410013-42410035 CTGATGACAGAGGGTCGGGAAGG - Intronic
1126002216 15:44221556-44221578 CTGAACACAAAGGGGCAGGAAGG + Intergenic
1126589312 15:50323465-50323487 CTGAGGACCCAGAGTGAGGCAGG + Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1126939599 15:53752579-53752601 CTGAAATCACAGTGTCAGCAGGG - Intronic
1128361545 15:66965171-66965193 CTCAAGACACACAGCCAGTAAGG + Intergenic
1128383933 15:67133868-67133890 CTAAAGTCACATAGCCAGGAAGG + Intronic
1129383956 15:75185492-75185514 CTGAGGTCACAGAGTTAGGCTGG + Intergenic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1131295865 15:91148610-91148632 CTGAAGAAACACAGTCAATAGGG + Intronic
1131337863 15:91567059-91567081 GTGAAAACACAGATTCTGGAAGG + Intergenic
1132249624 15:100325446-100325468 GTGAAGACACAGGGAGAGGACGG + Intronic
1132556971 16:576812-576834 CTGAAGGCCCAGAGGCAGCATGG - Intronic
1132592839 16:733862-733884 CTGAAGACACTCAGCCAGCAGGG - Intronic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133917955 16:10125998-10126020 GTGAAGGCAGGGAGTCAGGAAGG - Intronic
1133922090 16:10162547-10162569 GTGAAGACACAGGGAGAGGATGG - Intronic
1133946079 16:10349703-10349725 ATGGAGACACATAGTCAAGAAGG + Intronic
1134022856 16:10933485-10933507 CTGAGGTCACACAGCCAGGAAGG - Intronic
1135224107 16:20640619-20640641 CTGAATGCACAGAGCCAGGGTGG - Intronic
1135483569 16:22843837-22843859 CTGAAGACCCACAATCAGAAAGG + Intronic
1135819298 16:25666765-25666787 TTGAAAATACAGAGTCAGAAGGG + Intergenic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1138619806 16:58201756-58201778 CTGCACACACAGAGTAATGAGGG - Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1139249322 16:65479880-65479902 CTGAAGAAATAGAGGTAGGAGGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140149620 16:72348978-72349000 ATGAAGACAGAGAGACTGGAAGG - Intergenic
1141340571 16:83200119-83200141 CTTCAGACTCAGAGTCAGAAGGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1145367043 17:22273360-22273382 CTGAAATCCCTGAGTCAGGATGG - Intergenic
1145375444 17:22343421-22343443 CTGAAGAAACAGGGTGAGGGGGG - Intergenic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1148832824 17:50445990-50446012 CAGAAAACACAGCCTCAGGAAGG + Intronic
1150259527 17:63777255-63777277 CTGAAGAGAAACAGTCAAGATGG - Intronic
1151966535 17:77434467-77434489 CTGCAGACTCAGAGGCAGTACGG - Intronic
1152039684 17:77894697-77894719 CTGAGGACTCAGGGTCAGGCAGG + Intergenic
1152471633 17:80492778-80492800 CTGAGGTCACACAGCCAGGAGGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152804149 17:82347180-82347202 CTGGAGACAGAGAGACAGAAGGG + Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153859353 18:9185241-9185263 CTGTAGTCAGTGAGTCAGGAGGG + Intronic
1153917608 18:9759677-9759699 GTCAAGACAGAGAGACAGGAGGG + Intronic
1155791119 18:29971837-29971859 AAGAAGACACAGAGGCAGGCTGG - Intergenic
1156935559 18:42702011-42702033 CAGAAGAGACAAAGTCAGCATGG + Intergenic
1157102381 18:44742700-44742722 CTAAGGACACAGAGGCAGGCTGG - Intronic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157941290 18:51931620-51931642 GTGAAGACACTGAGGCATGATGG + Intergenic
1158170794 18:54596908-54596930 CTGATGACACAAAGACAGCAGGG - Intronic
1159001972 18:62982481-62982503 CTGAAGCCACAGTGTCTGCAGGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159478744 18:68959861-68959883 CTGAAGAGAGAGACTCAGGATGG - Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159820267 18:73132232-73132254 CTGAAGACACAGGGAGAAGATGG + Intergenic
1159923304 18:74246160-74246182 CTGAAGGCACAGAGTCCAGTAGG - Intergenic
1161137063 19:2626183-2626205 CTGGAGACACGGGGTCAGGTGGG - Intronic
1161186915 19:2927198-2927220 CTGATGACAGAGATTCTGGAGGG + Intergenic
1162034972 19:7933760-7933782 CTCAAGAAACGGACTCAGGAGGG + Intronic
1162398924 19:10432930-10432952 CTGGAGACACTGAGCCAGGCAGG - Intronic
1162956765 19:14103067-14103089 CTGAGGACACAGCATCAGGGAGG + Intronic
1163255869 19:16155500-16155522 TTGAAGCCCCAGGGTCAGGAAGG + Intronic
1163519284 19:17782363-17782385 CTAAAGACACAAAATCAGCAGGG - Intronic
1163989256 19:20983139-20983161 CTGTGGACACAGAGTAAAGAAGG - Intergenic
1164145331 19:22509435-22509457 ATGAGGACACAGACTCAGAAAGG + Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166062692 19:40336558-40336580 CTTAACTCACAGGGTCAGGAAGG - Intronic
1166128616 19:40731811-40731833 CCTAAGACCCACAGTCAGGAAGG + Intronic
1167304419 19:48698908-48698930 CAGAAGACACAGAGAGAGGCAGG - Intronic
925205673 2:2003635-2003657 CTGAAGACTCAGGTACAGGAAGG - Intronic
925437905 2:3857154-3857176 CAGAAGACAGAGGGTCAGGGAGG - Intergenic
925860872 2:8173800-8173822 GTAAAGACACAGAACCAGGAGGG + Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
926807924 2:16728919-16728941 CTGATGAGACATAGTCAAGAAGG - Intergenic
926889438 2:17626565-17626587 CTGCAGACACAGGGGCAGGGTGG - Intronic
926988179 2:18646879-18646901 CTGAAGACCCAGAGAAAGAAAGG - Intergenic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
928168550 2:28988513-28988535 CTGAAGACACAGGGGAGGGAGGG - Intronic
928188869 2:29143087-29143109 CTGAGGTCACAGAGCCAAGAGGG + Intronic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
928595457 2:32855468-32855490 CTCCAAACACTGAGTCAGGATGG - Intergenic
928626232 2:33142572-33142594 CTTAAGAGCCAGAATCAGGAGGG + Intronic
928681351 2:33706225-33706247 CTGAACACAAATTGTCAGGAGGG + Intergenic
929271938 2:39982223-39982245 CTGAAGACTCAGAGAAAGGCTGG + Intergenic
929505891 2:42527745-42527767 CTCAAGACACTGAGGTAGGAGGG + Intronic
929578754 2:43068813-43068835 CTGAGGTCACACAGTCAGAAGGG + Intergenic
931018534 2:58014860-58014882 CTAAAGACCCAGAACCAGGAAGG + Intronic
931581285 2:63778135-63778157 CTAAAGACTCAGAGACATGAAGG - Intronic
933158153 2:78996536-78996558 CTCAAGGCACAGGGTCAGGGAGG + Intergenic
934161870 2:89257452-89257474 CGGAAGACACAGAGGAAGGGAGG + Intergenic
934205412 2:89924910-89924932 CGGAAGACACAGAGGAAGGGAGG - Intergenic
934616057 2:95771938-95771960 CTGAAAAGTCAGAGCCAGGAGGG - Intergenic
934644839 2:96052622-96052644 CTGAAAAGTCAGAGCCAGGAGGG + Intergenic
934771136 2:96908193-96908215 CTGAGCACACAGAGTGTGGACGG + Intronic
934838248 2:97608711-97608733 CTGAAAAGTCAGAGCCAGGAGGG + Intergenic
934908675 2:98229795-98229817 CTGAGGTCACAGAGCCAGGAGGG + Intronic
935040077 2:99417584-99417606 GTGAAGACACAGGGAGAGGAGGG + Intronic
935186858 2:100742553-100742575 CTGTAGAAACTCAGTCAGGATGG - Intergenic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
935734781 2:106097801-106097823 AGGAACACACAGATTCAGGATGG + Intronic
937219013 2:120330809-120330831 GTGAAGACACAGGGAGAGGACGG + Intergenic
937356085 2:121199044-121199066 CTTAAGACCCACAGTCAGAAAGG - Intergenic
937368296 2:121280928-121280950 ATGAAGACACTGAGGCTGGAGGG + Intronic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
939722533 2:145672266-145672288 CTGAAGAAACAGAGGCAAAAAGG - Intergenic
940153684 2:150630341-150630363 ATGAAGACACACAGAAAGGAAGG + Intergenic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
941755741 2:169183925-169183947 CTGAAAACACAAAGGCAGAATGG - Intronic
941981612 2:171464451-171464473 TTGAAGACACAGAGGGAGAAAGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943117722 2:183693690-183693712 CAGAAGACAGAGAGTCAAAAAGG + Intergenic
943381600 2:187156656-187156678 GTGAGGACACAGAGAGAGGATGG - Intergenic
943651323 2:190460747-190460769 ATCAAGACACAGAGACAGGTGGG + Intronic
944175471 2:196823860-196823882 ATGAAGACACAGACTCAGAGAGG + Intergenic
944355029 2:198777688-198777710 CTTCAGACACAGACTCAGGAGGG + Intergenic
944438084 2:199712799-199712821 GTGAAGACACAGAGACATGGAGG - Intergenic
944531388 2:200670923-200670945 TTGAAGAGACAGAGTAATGACGG - Exonic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
945219416 2:207468743-207468765 CTTAAGACTCACAGTCAGGAAGG + Intergenic
946140995 2:217690475-217690497 ATGAAGACAGAGAGACAGCAGGG - Intronic
946461193 2:219870315-219870337 CTGAAGACACAGGGTAGGAAGGG + Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947797180 2:232901881-232901903 CTGGAGACACGGAGCCTGGATGG - Intronic
948150076 2:235738040-235738062 CTCAGGACACAGGGTCGGGACGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169052107 20:2588369-2588391 CTGAAATCAAAGAGTCAGCAGGG - Intronic
1169232957 20:3905026-3905048 CTGGAGCCCCAGAATCAGGATGG - Intronic
1169939808 20:10924778-10924800 GTGAAAGCTCAGAGTCAGGAGGG - Intergenic
1170034238 20:11973138-11973160 GGGAAGACACAAGGTCAGGAGGG + Intergenic
1171099368 20:22368110-22368132 GTGAAGGCAAGGAGTCAGGATGG + Intergenic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172197569 20:33102513-33102535 CTGCAGCCACAGAGCCAGGGAGG - Intronic
1172637967 20:36422735-36422757 CTGCAGACACAGAGGCACCATGG + Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173106503 20:40141833-40141855 CTGAATCCACAGGGTAAGGAGGG + Intergenic
1173226661 20:41166168-41166190 TGGAAGACACAGAGTGAGGGAGG - Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1176989561 21:15478920-15478942 CTGAAGACACAAATTAAAGAGGG + Intergenic
1177265012 21:18771669-18771691 CTGAAGCCATAGAGTCCTGAAGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178739596 21:35185957-35185979 CTGCAGTCACAAAGGCAGGATGG - Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1180153713 21:45966796-45966818 CTTAAGACCCACAGTCAGCAAGG - Intergenic
1180606401 22:17062105-17062127 CTGAAGTCACAGTGTCAGCACGG + Intergenic
1180722558 22:17920322-17920344 CCCAAGACACAGCGTCAGGCTGG - Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181689936 22:24553608-24553630 CCCAAGCCACAGAGTAAGGAGGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182473712 22:30564373-30564395 CAGAAGACAAAGAGGCAGGGAGG + Intronic
1182820766 22:33214254-33214276 CTGAAGACACAGGGAGAAGATGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184668150 22:45999284-45999306 CTGAAGCCAAAGAGTCTAGAAGG - Intergenic
1184725477 22:46342527-46342549 CTTAAGACCCACAGTCAGAAAGG + Intronic
1185181475 22:49365954-49365976 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181479 22:49365980-49366002 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185181497 22:49366078-49366100 CTGAGCACACACAGTGAGGAGGG + Intergenic
1185236561 22:49716828-49716850 ACGAAGACCCAGGGTCAGGAAGG + Intergenic
950166694 3:10806248-10806270 CTGAATACCCAGACTCAGGCAGG + Intergenic
950674321 3:14545411-14545433 ATGTGAACACAGAGTCAGGAGGG + Intergenic
951318762 3:21219651-21219673 CTGAAGACACAGCATAAGTATGG - Intergenic
951359156 3:21703940-21703962 CTCAAGACACAGATTCTGAAGGG - Intronic
951932645 3:27985921-27985943 ATGAAGACACAGAGAGAAGATGG + Intergenic
952283616 3:31947018-31947040 CAGAAGAGACAAAGGCAGGAGGG + Intronic
952314635 3:32221938-32221960 CTGAAGCCTCAGCTTCAGGAAGG + Intergenic
952657010 3:35799045-35799067 TTGAACACACAGAGATAGGATGG + Intergenic
952909538 3:38170596-38170618 TTGAAGACACAGAGACAGAAAGG + Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954065784 3:48104820-48104842 CTGAAGACCCACAGTCAGAAAGG + Intergenic
954092288 3:48294789-48294811 CTGAAACCACAGAGTCTGTAAGG + Exonic
955825204 3:62938804-62938826 CTGAAATCACAGTGTCAGCAGGG + Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
957947413 3:87082919-87082941 CTCTTGACACAGAATCAGGAAGG - Intergenic
958852481 3:99345728-99345750 CTGCAGACACAGTGTAAGGCAGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959686960 3:109158003-109158025 CAGAAGACAGAGAGTGAGGGGGG + Intergenic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961466562 3:127085321-127085343 CTGAGGACACACAGCCAGCAAGG - Intergenic
961509755 3:127393615-127393637 GGGAAGGCCCAGAGTCAGGAAGG + Intergenic
961798298 3:129425467-129425489 CTGAAAACCCAGAGCCAGGAAGG - Intronic
962321726 3:134396161-134396183 CAGGAGACAAAGAGACAGGAAGG - Intergenic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
963376636 3:144474907-144474929 ATGAAGACAAAGAGTCAAGATGG - Intergenic
963993960 3:151685205-151685227 CTTAAGACCCACAGTCAGAAAGG - Intergenic
964373113 3:156022206-156022228 CTGAGGCCAGAGAGTCAGCAGGG + Intergenic
965449213 3:168816825-168816847 CTGAAGGCAGAGAGTCAGTGAGG + Intergenic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
967329349 3:188275153-188275175 GTGATGACCCAAAGTCAGGATGG - Intronic
967923779 3:194631306-194631328 CTGGAGACACCGAGACAGGGTGG + Intronic
968500745 4:948725-948747 ATGAGGACACAGAGCCAGGCAGG - Intronic
968615426 4:1575556-1575578 AGGAAGACAGAGAGGCAGGACGG + Intergenic
969336701 4:6514791-6514813 CTGAAAACATAGTGTCAGCAGGG + Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971700923 4:29974238-29974260 ATGAAGACACAGTGTAAGAAAGG - Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
972800880 4:42474568-42474590 CTGAAGGCACAGAGCCAGGCAGG + Intronic
975271388 4:72438084-72438106 CTGCACACACAGAGTAAAGATGG - Intronic
975366630 4:73536901-73536923 CTGATGTCACACAGTCAGTAAGG + Intergenic
975974775 4:80082184-80082206 CTGAGGACACAGTGACAAGATGG - Intronic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
978541551 4:109821550-109821572 CTGAACACACAAAGTAATGAAGG - Intronic
980956143 4:139431005-139431027 CTGAAGACCATGAGTCTGGATGG + Intergenic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
981073075 4:140565588-140565610 GTGAAGCCACAGAGACAGGAGGG - Intronic
982068496 4:151674918-151674940 CTGCAGACGCAGACCCAGGAGGG - Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983960169 4:173742831-173742853 GTGAAGACACAGAGAGATGATGG + Intergenic
985246718 4:187986457-187986479 AGGAAGACACAGAGACAGGAAGG + Intergenic
985947967 5:3201327-3201349 CAGAAGCCAGAGAGTCAGGAGGG - Intergenic
985996623 5:3600575-3600597 CGGAAGAGGCAGAGTTAGGACGG - Intronic
986011336 5:3718602-3718624 CTGAAGACCCAGAGAGAAGATGG + Intergenic
986405548 5:7421305-7421327 CTGAAATCACAGTGTCAGCAGGG + Intronic
987662738 5:20898284-20898306 CTGAAGACACACAGTTAGTGAGG + Intergenic
990605720 5:57407925-57407947 TTGAAGACACAGAGAGAAGATGG + Intergenic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992947758 5:81826100-81826122 ATGAGGACACAGGCTCAGGAGGG + Intergenic
993031661 5:82713475-82713497 CTGGAGACAGAGAGCCAGGTTGG + Intergenic
993597668 5:89879738-89879760 TTGAATACACTGAATCAGGATGG - Intergenic
994845623 5:104985716-104985738 TTGAAAATACACAGTCAGGATGG - Intergenic
994926482 5:106122443-106122465 AGGAAGACACAGAGCCAGCAAGG - Intergenic
995450186 5:112291579-112291601 CTTAAGACCCACAGTCAGAAAGG - Intronic
996255168 5:121392008-121392030 CTGAAGACACAGGATCATCAGGG + Intergenic
996424183 5:123294697-123294719 CTAAAGCCACAGTGACAGGAAGG + Intergenic
997438910 5:133895121-133895143 CTGAAAGCAAAGTGTCAGGAGGG + Intergenic
997532300 5:134589253-134589275 TAGGAGGCACAGAGTCAGGACGG + Intergenic
997745680 5:136298308-136298330 CTGAAGGAACAGAGGCAGGCAGG + Intronic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
998422349 5:141999163-141999185 AGGAAAACACAGACTCAGGAAGG + Intronic
999838487 5:155399968-155399990 ATGAAGACACAGAGACAGACAGG - Intergenic
999852560 5:155558669-155558691 CTGAGGAAACAGAGTCAGAGAGG + Intergenic
1000483720 5:161812352-161812374 CTGAAGAATCAGAGTCTGAAGGG + Intergenic
1001803900 5:174567104-174567126 TTGAAGACACAAAGGCTGGAGGG + Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002562562 5:180092222-180092244 CTGAGCACACCGAGTCAGGCTGG - Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1003912609 6:10756095-10756117 CTGAAGCAAAAGAGTCAGTATGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004294090 6:14394613-14394635 CTTAAGACCCACAGTCAGAAAGG - Intergenic
1004306758 6:14508289-14508311 CTCAAGACACAAGGTCAGAAAGG - Intergenic
1005368517 6:25105167-25105189 GTGAAGAGACAGAGTAAAGATGG + Intergenic
1005823752 6:29619428-29619450 CTCTAGACACAAAGTCAGAAAGG + Intronic
1005984743 6:30864365-30864387 CTGAGCACACAGCTTCAGGAGGG - Intergenic
1006942046 6:37758874-37758896 CGGATGACACAGAGCCAGGAGGG + Intergenic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1007548779 6:42713276-42713298 CTGAAAAGACAGAGTCAGTGAGG + Intronic
1007926653 6:45655008-45655030 CTATAGCCACTGAGTCAGGAGGG - Intronic
1008048191 6:46873133-46873155 TTAAAGACACAGGGTGAGGAAGG - Intronic
1008206911 6:48671479-48671501 CAGTAGACCCAGAGTCAGCAAGG + Intergenic
1008554663 6:52663296-52663318 CTGAGGACAGAGAGTCAGCCTGG + Intergenic
1010969994 6:82253141-82253163 CTTAAGACCCAGAGTCAGAAAGG - Intergenic
1011489949 6:87881266-87881288 CTGAAGCCACAGATTCAGAGTGG + Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1013491651 6:110652747-110652769 ATGAAGACACAGAGAGAGAAAGG + Intronic
1013510558 6:110840724-110840746 CTTAAGACCCACAGTCAGAAAGG + Intronic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1015774094 6:136795991-136796013 CTTAAGACCCACAGTCAGAAAGG + Intergenic
1015899669 6:138051821-138051843 CTGAAGGCAAAGACTCAGGGTGG + Intergenic
1016812360 6:148273588-148273610 CTTAAGAGACAGGGTCAGGCTGG - Intronic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1017602662 6:156100535-156100557 TCGAAGGCACAGAGGCAGGAAGG - Intergenic
1017675533 6:156809986-156810008 CTGAGGAATCAGATTCAGGAGGG + Intronic
1018500627 6:164407006-164407028 CTGAAATAACAGAGCCAGGAAGG - Intergenic
1018574931 6:165250183-165250205 CTGAAGACACAGTGACTGGTAGG - Intergenic
1018706142 6:166464504-166464526 CTGGAGACACACAGTCACCAGGG - Intronic
1018751444 6:166810073-166810095 CTGAAGACAAGGTGGCAGGATGG + Intronic
1018914717 6:168125972-168125994 CTGCAGACACAAAGTCGAGAAGG - Intergenic
1020531239 7:9338539-9338561 AGGAAGACAAAGAGTGAGGAAGG + Intergenic
1022415313 7:30172168-30172190 CTGAAGGCACAGAGTCTCGAAGG - Intergenic
1023776771 7:43615535-43615557 CTGAGGACTCATAGTCATGATGG + Intronic
1024094254 7:45971807-45971829 CTGATGATTCAGAGTGAGGAGGG - Intergenic
1024337061 7:48219757-48219779 CTGTGGAGACAAAGTCAGGATGG - Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024984448 7:55183068-55183090 CAGAAGCCAGAGAGGCAGGAAGG - Intronic
1026418234 7:70205288-70205310 CTCAGGAGACAGAGGCAGGAGGG - Intronic
1026458632 7:70594556-70594578 TTGAATACACAGAGTCTAGAAGG - Intronic
1026706831 7:72701369-72701391 CTGAGGATGCTGAGTCAGGAGGG - Intronic
1026831836 7:73615154-73615176 CTGAAGTCACACAGCCAGCAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1030112775 7:106040801-106040823 CAGAGGTCACAGAGCCAGGATGG + Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030412418 7:109198134-109198156 ATGCAGACACAGAGGCCGGAGGG + Intergenic
1030903266 7:115150325-115150347 CTGAGGATACAGACACAGGATGG - Intergenic
1031268055 7:119607470-119607492 CTGAAGACACTGGGGTAGGATGG + Intergenic
1031569438 7:123341007-123341029 CTGAGGACAGAGAGAAAGGAGGG - Intergenic
1032792274 7:135251363-135251385 CTGAATCCAGAGGGTCAGGAAGG - Intronic
1033448046 7:141439056-141439078 CTGCAGACAAAGAGCCAGCATGG - Intronic
1033570905 7:142627393-142627415 CTAGAGACACAGCGCCAGGAGGG + Intergenic
1034042882 7:147897954-147897976 CAGAAGACACAGCTTCAGGGTGG + Intronic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034701311 7:153098712-153098734 CTGAAAACACACTGTCAGCAGGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035251336 7:157599433-157599455 CTGAATACACAGTGTAAAGATGG + Intronic
1035526244 8:315507-315529 GTGAAGACACAGGGAGAGGATGG - Intergenic
1035850185 8:2911397-2911419 CTGAAAACACAGAATCTTGAAGG + Intergenic
1035962283 8:4150342-4150364 CTGCAGACACTGAGTTAGAATGG - Intronic
1036685111 8:10904399-10904421 CCGATGACACAGAGCCAGAAAGG + Intronic
1037305552 8:17499419-17499441 CTGAACACACAGAGAGAGAAGGG - Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1037979319 8:23239642-23239664 CTCATGACACAGACTCAGGAAGG - Intergenic
1038146767 8:24904558-24904580 GTGAAGACACAGGGAGAGGACGG + Intergenic
1038272809 8:26089675-26089697 CTGAAGACGTAGATTCAGGAAGG - Intergenic
1038315879 8:26483971-26483993 CTGCAGACAAGGCGTCAGGAGGG - Intronic
1038976345 8:32700930-32700952 TTGAAGACCCAGAGGCAGGAGGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039727410 8:40233751-40233773 GTGAAGACACAGAGACAGAATGG + Intergenic
1039804542 8:40987075-40987097 CTTAAGACCCACAGTCAGAAAGG + Intergenic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1040039123 8:42897852-42897874 CTGAAGACCCGGCTTCAGGAAGG - Intronic
1040482641 8:47840882-47840904 CTGAATAGACATAGCCAGGAGGG + Intronic
1040533754 8:48288044-48288066 ATGAAGACCTAGAGTCAGAAGGG + Intergenic
1040569482 8:48595137-48595159 CTGAAGACTCAGTGTCAGCTCGG - Intergenic
1040741489 8:50580710-50580732 CTCAAGAAACACAGTCATGATGG - Intronic
1040856026 8:51948768-51948790 TTGAAGACACAGAGAGAAGAGGG + Intergenic
1040973444 8:53163444-53163466 CTGAGGATACAGAGCCAGGACGG - Intergenic
1042149566 8:65767557-65767579 CTTAAGACTCACAGTCAGAAAGG - Intronic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042721610 8:71832786-71832808 CTGAAGACCCACAGTAAGCAGGG + Intronic
1044490555 8:92809242-92809264 CTGAAGGCACAGGCACAGGATGG + Intergenic
1045429046 8:102096278-102096300 GTGAAGACACAGGGAGAGGAAGG - Intronic
1045864805 8:106852730-106852752 GTGAGGACACAGTGACAGGATGG - Intergenic
1046136542 8:110034573-110034595 ATGAAGACACATTTTCAGGAGGG + Intergenic
1046790571 8:118317291-118317313 CTGGTGACACATACTCAGGATGG - Intronic
1047004718 8:120608498-120608520 ATGAAGACACAGAGAGAAGACGG + Intronic
1047192812 8:122693676-122693698 CTGAACATAGAGAGGCAGGAAGG + Intergenic
1047193544 8:122700495-122700517 CTGAAGACACAGGGAGAGGATGG + Intergenic
1048635126 8:136287073-136287095 GTGAGGACACAGTGTGAGGATGG + Intergenic
1049025353 8:139984549-139984571 CTCAAGACACAAAGCCTGGAAGG + Intronic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049798781 8:144508380-144508402 CTGAAGCCACAGACACAGCAAGG + Intergenic
1050150921 9:2618787-2618809 CTAAAGACACATAGACAGCAGGG + Intergenic
1050844658 9:10199687-10199709 CTTAAGACACAAAACCAGGAAGG + Intronic
1051224350 9:14883243-14883265 CTGAAGCAACACAGTTAGGAGGG + Intronic
1051739463 9:20237532-20237554 CTGAAGACACAGACTAGAGAAGG + Intergenic
1052883216 9:33618502-33618524 CTAGAGACACAGCGCCAGGAGGG + Intergenic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055011339 9:71569342-71569364 CTGAAGTCAAAGTGTCAGCAGGG - Intergenic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056507592 9:87271614-87271636 CTGAAGACACGGAGTGAAGAAGG - Intergenic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1056808988 9:89749914-89749936 CTGAGGTCACACAGTGAGGATGG + Intergenic
1057023840 9:91721285-91721307 AGGAAGCCACAGAATCAGGAAGG + Intronic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057413975 9:94845236-94845258 GACAAGACACAGAGTCAGGTGGG + Intronic
1057441056 9:95083778-95083800 CTCAAGACACAGGGTCATGGAGG - Intronic
1057479243 9:95431270-95431292 CTCAGGACAGACAGTCAGGAAGG - Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059097700 9:111436323-111436345 CTGATGACACAGACACAGTAAGG + Intronic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059561628 9:115340410-115340432 CAGAGGACACAGAGCCAGGCAGG + Intronic
1059910148 9:119034362-119034384 GTGAAGACACAGGGAGAGGATGG - Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1061404522 9:130385987-130386009 CTGAGGAAACCGAGGCAGGAAGG - Intronic
1061617705 9:131791252-131791274 CTGAATACACGAAGCCAGGAGGG + Intergenic
1062278518 9:135741749-135741771 CTGAGGCCACACAGGCAGGAAGG - Intronic
1062585841 9:137249580-137249602 CTTAAGACCCACAGTCAGAAAGG - Intergenic
1185478105 X:427315-427337 CTGATGCCCCAGAGACAGGACGG + Intergenic
1185478124 X:427396-427418 CTGATGCCCCAGAGACAGGACGG + Intergenic
1186367094 X:8906987-8907009 CTAAGGACACAGAGTGAGGTAGG + Intergenic
1186986842 X:15026242-15026264 CTGAAGAGACATTTTCAGGAGGG + Intergenic
1187472616 X:19582445-19582467 CTGAAGATACCGAGGAAGGAGGG - Intronic
1187489770 X:19739989-19740011 CAGAAGACACAGAGATAGAAAGG + Intronic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188364768 X:29302118-29302140 CTGAAGACAGTGATCCAGGATGG + Intronic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189715426 X:43860052-43860074 GTGAAGACAGTGAGTCAAGAGGG - Intronic
1190414064 X:50163973-50163995 CTTAAGACCCACAGTCAGAAAGG + Intergenic
1192065452 X:67880145-67880167 CTGAAGACAGAGACTCAGTGAGG + Intergenic
1192226902 X:69235210-69235232 TTAAAGCCACACAGTCAGGAGGG + Intergenic
1192681850 X:73260955-73260977 CTGAAGAAGTAGAATCAGGAAGG - Intergenic
1194880216 X:99241892-99241914 TTGAATATACACAGTCAGGATGG + Intergenic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195763007 X:108267201-108267223 CTGAAGACAGTGTGTCAGAATGG - Intronic
1196872627 X:120127198-120127220 CTCAAGACAGAGATCCAGGAAGG - Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1197160781 X:123319706-123319728 ATAAAGACACAGAGGCAAGAAGG - Intronic
1197469992 X:126855647-126855669 CTGAAGCCACAGAGTCTCAAAGG - Intergenic
1197620474 X:128742187-128742209 CTGAATATACAGGATCAGGAAGG + Intergenic
1198078786 X:133219158-133219180 CTGAAGACACAGAGCCTGTGTGG - Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic