ID: 907401467

View in Genome Browser
Species Human (GRCh38)
Location 1:54227332-54227354
Sequence CAGGATAAGGGCCAGGAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 2, 2: 7, 3: 45, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907401467 Original CRISPR CAGGATAAGGGCCAGGAGGC GGG Intronic
900340050 1:2184067-2184089 CAGGAAAATGCCCAGCAGGCGGG - Intronic
900516567 1:3085016-3085038 CAGGAAAAGGGGCTGGATGCTGG - Intronic
900903649 1:5535243-5535265 CAGGACACAGGCCTGGAGGCAGG - Intergenic
900971308 1:5993631-5993653 CAGGACAAATGCCAGGAGGAGGG - Intronic
901236434 1:7669914-7669936 CAGGACAATGGCCATGAAGCAGG + Intronic
901464750 1:9413884-9413906 CAGGACCAGGGCCAGGAGGCTGG + Intergenic
902557598 1:17256149-17256171 CAGGAAACGGGTCTGGAGGCAGG - Intronic
902674942 1:18002222-18002244 CAGGAGAAGGGCTTGGAGCCTGG + Intergenic
902687203 1:18086049-18086071 GAGGACTGGGGCCAGGAGGCTGG - Intergenic
903065268 1:20696190-20696212 GAGGACACGGGCCAGGAGCCGGG - Intronic
903134336 1:21299490-21299512 CAGGAATAGGGCTGGGAGGCTGG + Intronic
904200614 1:28816901-28816923 CAGGATCTGGGCCAGGCGGGAGG - Intronic
904257824 1:29267565-29267587 CAGCACAAAGGCCTGGAGGCTGG + Intronic
904391799 1:30190907-30190929 CAGGATGGGCACCAGGAGGCAGG + Intergenic
904439961 1:30523938-30523960 CATGATCTGGGCCAGGTGGCAGG - Intergenic
904495312 1:30883264-30883286 CAGGCTGGGGGCCAGGAGCCCGG + Intronic
904983700 1:34527289-34527311 AAGGATAAGGCCCACGAGGGCGG - Intergenic
905034659 1:34909903-34909925 CAAGATAAGGACAAGGAGGCTGG - Intronic
905038163 1:34930342-34930364 CAGGCTCAGGGCCCAGAGGCGGG - Intergenic
906040508 1:42785013-42785035 CAGGAAACGGGGCAGGAGGGCGG + Intronic
906151991 1:43592822-43592844 CGGGAGGAGGGGCAGGAGGCTGG - Intronic
906291720 1:44623736-44623758 CAAGATAAGGTCCAGGAGGCAGG + Intronic
906687050 1:47769552-47769574 CAGAATCAGGCCCAGGAGGTGGG - Intronic
907184316 1:52598184-52598206 AAGTACAAGGGCCTGGAGGCAGG - Intergenic
907198138 1:52703766-52703788 AAAAAAAAGGGCCAGGAGGCCGG + Intergenic
907401467 1:54227332-54227354 CAGGATAAGGGCCAGGAGGCGGG + Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908077772 1:60539905-60539927 CAAGCTAAGGGCCAGGAGCTAGG - Intergenic
909180309 1:72415673-72415695 CAGGAGCAGGACCAAGAGGCAGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
911042473 1:93601797-93601819 GAGGAGAAGGGAGAGGAGGCTGG + Intronic
911729488 1:101278195-101278217 CAGTATAAGCCCCAGGGGGCAGG + Intergenic
913326206 1:117630808-117630830 AAGGCACAGGGCCAGGAGGCAGG - Intergenic
913590951 1:120324080-120324102 CAGGGAAAGGGACATGAGGCAGG + Intergenic
913652417 1:120931023-120931045 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914168691 1:145198027-145198049 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914523812 1:148441986-148442008 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914599862 1:149193862-149193884 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914642593 1:149625154-149625176 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914803193 1:150974853-150974875 CAGCCCAAGGGCCGGGAGGCTGG + Exonic
915109198 1:153552458-153552480 GAGGACAAGGGCAAGGAGCCGGG - Intergenic
915468694 1:156113365-156113387 CAGGATAGGGGCCAGGATGAGGG + Intronic
915588527 1:156858055-156858077 CAGGACAGGGCCCTGGAGGCAGG + Intronic
915641149 1:157227607-157227629 CAGGATCAGGGCCAAGGGGTAGG + Intergenic
915668342 1:157465341-157465363 CAGGAGCAGGGCCAAGGGGCAGG - Intergenic
915933882 1:160078643-160078665 CAGGACCAGGCCCAGGAGACGGG + Intergenic
916374681 1:164139452-164139474 AAGGAAAAGGGGCAGGTGGCTGG + Intergenic
916418659 1:164615923-164615945 GAGGTTAAGAGCCAGGAGTCTGG + Intronic
917735153 1:177913449-177913471 CAGGATATGCGCCGTGAGGCAGG + Intergenic
918204669 1:182298194-182298216 GAGGATGTGGGGCAGGAGGCTGG - Intergenic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
920216568 1:204365312-204365334 CAGCATTATGGCCTGGAGGCAGG + Intronic
920220192 1:204391762-204391784 CAGCACAAGGGACAGGAGGAAGG + Intergenic
920340400 1:205272036-205272058 CAGGACGAGGACCAGGAGGGTGG - Exonic
920430764 1:205917421-205917443 CAGGAAAAGGGACAGGTGGCCGG + Intronic
920819752 1:209369374-209369396 CAGGAAAATGGCCAGGAGGGTGG + Intergenic
921945641 1:220884258-220884280 AAGGACAAGGACAAGGAGGCTGG + Exonic
924396186 1:243623666-243623688 GAGGCTAAGGGCCAGGAACCTGG - Intronic
1063352073 10:5365161-5365183 CAGCTTCAGGGCCAGGAGGGCGG - Exonic
1063636471 10:7787747-7787769 CAGGATCAGGTCCTGGACGCGGG - Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064321486 10:14309655-14309677 CAGGAGGGGGGCCTGGAGGCTGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064724038 10:18259336-18259358 CAGGAGAATGGCCTGGAGCCAGG + Intronic
1065541950 10:26779317-26779339 CAGGATAAGTACCAGGAAGTAGG + Intronic
1065861914 10:29879037-29879059 CAGCAAAAGGTCCAGGAGCCAGG + Intergenic
1065920980 10:30392608-30392630 CAGGATCAGGGTGGGGAGGCAGG + Intergenic
1066546240 10:36503414-36503436 CAGGATAAGATCCAGGTGTCAGG - Intergenic
1066804519 10:39232258-39232280 CAGGATTACAGCCAGAAGGCAGG + Intergenic
1067439798 10:46302171-46302193 CAGCATCAGGGCCAGGACTCAGG - Intronic
1067581877 10:47451446-47451468 CAGGGCCAGGGCCAGGAGGCGGG + Intergenic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1067993457 10:51242160-51242182 CAGGATAAAAGACAGGAGGCTGG + Intronic
1069112449 10:64464369-64464391 CATGAAAATGGCTAGGAGGCAGG - Intergenic
1069977404 10:72225380-72225402 CATGAGAAGGGCCTGGATGCTGG - Intronic
1071397535 10:85238420-85238442 CTAGATGAGGGGCAGGAGGCAGG + Intergenic
1071528131 10:86370118-86370140 CAGGATTGTGCCCAGGAGGCAGG - Intergenic
1072245701 10:93542115-93542137 CAGGTTAAGGACCATGAGTCAGG + Intergenic
1072626430 10:97115315-97115337 CAGGATAAGTACCAGCAGGAAGG - Intronic
1072806292 10:98425723-98425745 GAGGGTAAGGGCCGAGAGGCGGG + Intronic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074307555 10:112292876-112292898 CAGGATAAAGGCCCTGGGGCAGG - Intronic
1075155620 10:119974093-119974115 CAGTAACAGGGCCAGGAGCCAGG + Intergenic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076271295 10:129154524-129154546 CTCAATAAGGGACAGGAGGCAGG - Intergenic
1076474028 10:130740046-130740068 CAGGAGAAGGCCCAGGAGAGAGG + Intergenic
1076512956 10:131025308-131025330 GAGGACATGGGCCAGGAGGAAGG + Intergenic
1076551169 10:131278937-131278959 CAGCAGAAGGGCCCGGAGGGAGG - Intronic
1077042758 11:531805-531827 CATGTGAAGGCCCAGGAGGCGGG + Intergenic
1077192858 11:1262738-1262760 CAGGAGGCGGGACAGGAGGCGGG - Intergenic
1077192862 11:1262750-1262772 CAGGAGGCGGGACAGGAGGCGGG - Intergenic
1077192872 11:1262786-1262808 CAGGAGGTGGGACAGGAGGCGGG - Intergenic
1077395000 11:2316342-2316364 CAGGCTGAGGGGCAGGAGGTGGG - Intronic
1078062864 11:8059693-8059715 CAGGAGAGGGGTCAGGGGGCAGG + Intronic
1078089584 11:8256457-8256479 CAGGGGAAGGGACAGGAGGGAGG + Intronic
1078307446 11:10204544-10204566 CAGGAGAATGGCGTGGAGGCAGG + Intronic
1078849495 11:15151092-15151114 CAGGCTAAGGACCAGGAGTTGGG - Intronic
1079080599 11:17411035-17411057 CAGGAGAAGGCCCAGACGGCAGG - Intronic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1082768498 11:57187326-57187348 CAGGGTCAGGGTCAGGTGGCAGG - Exonic
1083310361 11:61780732-61780754 CCGGAGCAGGGCCAGGAGACAGG - Exonic
1083475038 11:62909973-62909995 GAGGATGAAGGCCAGGAGGATGG + Exonic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083680440 11:64349292-64349314 CAGGCTCAGGGCAAGGGGGCAGG - Intronic
1083762100 11:64824281-64824303 CAGGATGAGGGCTGGGAGTCAGG + Exonic
1083937872 11:65879877-65879899 CACCAACAGGGCCAGGAGGCAGG - Exonic
1084358378 11:68653919-68653941 CTGGAAAGGGGCCAGGAGGAGGG + Intergenic
1084380539 11:68809680-68809702 CAGGAAATGGCCCATGAGGCTGG + Intronic
1084454606 11:69261219-69261241 CAGGAGATGGGGCAGGAGACTGG - Intergenic
1084519974 11:69657123-69657145 AGGGAGATGGGCCAGGAGGCAGG - Intronic
1084890102 11:72232565-72232587 CAGGGTCAGGGCCAGAAGTCAGG - Intronic
1085045248 11:73348972-73348994 AGGGACAAAGGCCAGGAGGCTGG + Intronic
1085056125 11:73405049-73405071 GAGGATGAGGCCCAGGAGACAGG - Intronic
1085479664 11:76810696-76810718 CAGGAAGGAGGCCAGGAGGCAGG + Intergenic
1085929271 11:81061659-81061681 CAGGAAAAGGGTCTGGAGGCAGG + Intergenic
1086122837 11:83318143-83318165 GAGGAGAAGTGCCAGGATGCAGG + Intergenic
1086194060 11:84115857-84115879 GAGTATAAGCTCCAGGAGGCAGG + Intronic
1087708805 11:101525820-101525842 GAGGATCAGGGTCAGGAAGCAGG + Intronic
1089148224 11:116345892-116345914 CAAGAAAAGGGACAGGAGGCAGG - Intergenic
1089581119 11:119482569-119482591 CAGGCTTGGGGCCAGGAGGCAGG + Intergenic
1089606804 11:119646035-119646057 CAAGGAAAAGGCCAGGAGGCAGG - Intronic
1089683943 11:120134993-120135015 CATGATGTGGGTCAGGAGGCAGG - Intronic
1090056825 11:123430946-123430968 CAGGAGCAGAGCCTGGAGGCCGG + Exonic
1090317525 11:125807052-125807074 CTGACTGAGGGCCAGGAGGCAGG + Intergenic
1090966400 11:131601101-131601123 TTGGGTAAGGGCCAGGAGGCAGG + Intronic
1091209171 11:133842118-133842140 GAGGAGAAGGGCCAGGTGGAGGG + Intronic
1091666823 12:2424829-2424851 GCTGATAAGGGCCAGGAAGCGGG + Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091829462 12:3539443-3539465 CAGGATAGGACCCAGGAGCCTGG + Intronic
1092171252 12:6375258-6375280 CAGGATTAGAGAGAGGAGGCAGG - Intronic
1092761997 12:11818891-11818913 TAGGCTGAGGGCCAGGAGGGAGG - Intronic
1092955654 12:13547188-13547210 CAGGAGAGCTGCCAGGAGGCTGG + Exonic
1094565135 12:31591707-31591729 CAGGATAAATGACAGAAGGCGGG - Intergenic
1095225369 12:39672045-39672067 CAGGACAAGCGCCAGGACTCTGG + Intronic
1096514760 12:52149717-52149739 CAGGACAGGGGGCAGGAGGAGGG - Intergenic
1096520089 12:52180195-52180217 TCGGACAAGGGTCAGGAGGCTGG - Intronic
1096899431 12:54859741-54859763 CAGGGTCAGAGCCAGGAGTCAGG - Intergenic
1099780128 12:87183428-87183450 CAGGACAACAGCCAGGAGGGAGG + Intergenic
1100611604 12:96195124-96195146 CAGGCTGAGTGCCTGGAGGCTGG + Intronic
1101414422 12:104497023-104497045 CAGGAGAGGTCCCAGGAGGCAGG - Intronic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1102847675 12:116204720-116204742 TAGGATAAAGGGCAGGAGCCAGG - Intronic
1102897918 12:116613297-116613319 CAGGGTCAGTGCCAGGAGGTGGG + Intergenic
1104039649 12:125121634-125121656 CAGAATTAGGGCCAGGACCCCGG + Intronic
1104044388 12:125151564-125151586 GAGGATAAGGGCTCTGAGGCTGG + Intergenic
1104658008 12:130588202-130588224 CATGAGAAGGGGCTGGAGGCTGG - Intronic
1104861822 12:131928022-131928044 CAGTGCAAGAGCCAGGAGGCAGG - Intergenic
1105279122 13:18952988-18953010 CAGGATGGGCTCCAGGAGGCAGG + Intergenic
1105308991 13:19189706-19189728 CAGGACATGGGCCAGGAAGCTGG + Intergenic
1105528611 13:21198445-21198467 CAGGACATGGGCCAGGAAGCTGG - Intergenic
1105567278 13:21562674-21562696 CGGTATAAGGGACAGGAGGGAGG - Intronic
1105910797 13:24864207-24864229 CAGGAGCAGGGCTAGGAGGGAGG + Intronic
1106705915 13:32279333-32279355 CTGCGTAAGGGCCCGGAGGCAGG + Intronic
1107188416 13:37550163-37550185 CAGGAAAGCGGCCAGGAGGGAGG + Intergenic
1107456879 13:40563362-40563384 CAGGGTAAGGCCCAGCAGTCAGG + Intronic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1112159712 13:96854636-96854658 GAGCATGAAGGCCAGGAGGCAGG + Intergenic
1112182281 13:97095368-97095390 CAGGATGAGGGGCAGGAAACGGG + Intergenic
1113185519 13:107682358-107682380 CAGGATGAGTGCAAGGAGGGTGG - Intronic
1113366443 13:109681080-109681102 CAGGATGAGGGACAGGTGGCTGG - Intergenic
1114636174 14:24188239-24188261 CAGGATCAGGGACTTGAGGCTGG + Exonic
1114682589 14:24498912-24498934 CAGGGTCAGGGCCGGGAGTCAGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1118258744 14:64227714-64227736 CAGGATAAGGGCCTTTAAGCTGG + Intronic
1119491603 14:75038948-75038970 CAGGAGAATGGCATGGAGGCAGG - Intronic
1120620361 14:86755759-86755781 CAGCATAAGGGGTAGAAGGCAGG + Intergenic
1121034460 14:90688901-90688923 AAGGAGAAGGGCTGGGAGGCTGG - Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121525145 14:94614337-94614359 CAGGACAGGGACCAGGACGCAGG + Exonic
1122270212 14:100565619-100565641 CAGTCCAGGGGCCAGGAGGCAGG + Intronic
1122835058 14:104426788-104426810 AAAAAAAAGGGCCAGGAGGCAGG + Intergenic
1122862466 14:104588710-104588732 CAGGACAAGGCCGAGGAGCCGGG - Exonic
1123125937 14:105946025-105946047 CAGGAGAAGGCCCAGGAGAAGGG + Intergenic
1123406520 15:20022443-20022465 CAGGAGAAGGCCCAGGAGAAGGG + Intergenic
1123515850 15:21029091-21029113 CAGGAGAAGGCCCAGGAGAAGGG + Intergenic
1123820981 15:24030460-24030482 GAGAATAGGGGCCTGGAGGCAGG - Intergenic
1125359369 15:38849532-38849554 CAAGGTAAAGGCCAAGAGGCAGG + Intergenic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128866827 15:71120577-71120599 CTGGCCAAGGGCCAGGAGGGTGG - Intronic
1129179722 15:73866377-73866399 CAGGATAGGAGGCAGGAGACTGG + Intergenic
1129741561 15:77992075-77992097 CAGGAGCAAGGCTAGGAGGCTGG + Intronic
1129844085 15:78760304-78760326 CAGGAGCAAGGCCAGGAGGCTGG - Intronic
1130257716 15:82333496-82333518 CAGGAGCAAGGCCAGGAGGCTGG + Intergenic
1130583074 15:85155729-85155751 GAGGGTGCGGGCCAGGAGGCGGG - Intergenic
1130597219 15:85256467-85256489 CAGGAGCAAGGCCAGGAGGCTGG - Intergenic
1132079608 15:98852848-98852870 CAGAATAAGGGCAGGGATGCCGG - Intronic
1132468238 16:87660-87682 CAGGAGAATGGCCTGAAGGCGGG - Intronic
1132713665 16:1280066-1280088 CAGGAACAGGGCCTGGAGGCGGG + Intergenic
1132748748 16:1447688-1447710 CAGGATCAGGCCCTGGAGCCGGG + Exonic
1132869898 16:2111306-2111328 CAGGCTCCGGGCCAGGTGGCCGG + Exonic
1132884059 16:2174733-2174755 CACGATAGGAGACAGGAGGCAGG - Intronic
1132942804 16:2516548-2516570 CAGGCCAAGGGCCAGGAGCTGGG - Intronic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133718678 16:8473918-8473940 CAAGATAAGGGCTTGTAGGCTGG + Intergenic
1133731521 16:8582389-8582411 CAGGTTCAGAGCCATGAGGCAGG - Intronic
1133988235 16:10684696-10684718 CATGACAAGGGCCAGGCAGCTGG - Intronic
1134717524 16:16364295-16364317 CAGGCTCCGGGCCAGGTGGCCGG - Intergenic
1134957228 16:18387864-18387886 CAGGCTCCGGGCCAGGTGGCCGG + Intergenic
1135465082 16:22677858-22677880 CTGCATCAGGGCCAGGAAGCTGG - Intergenic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1136172397 16:28496833-28496855 CAGGAGAGGAGCCTGGAGGCAGG + Exonic
1136841543 16:33545942-33545964 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1137246479 16:46710153-46710175 AAGGCTAAGGCCCAGGAGTCTGG - Intronic
1137291583 16:47055377-47055399 CAGGAGCAGGGACAGGAGGCTGG + Intergenic
1137650341 16:50114640-50114662 CAGGATGAGGGCAGGAAGGCGGG - Intergenic
1138198891 16:55074417-55074439 GAGGACAAGGGCCAGGAGGGTGG + Intergenic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1138531048 16:57634600-57634622 CAGGCTAAGAGGCAGGAGACTGG - Intronic
1139234380 16:65319069-65319091 CTGAATAAAGGCCTGGAGGCAGG + Intergenic
1139555673 16:67708378-67708400 CAAGCTAAGGCCCAGTAGGCTGG + Intronic
1139572319 16:67820994-67821016 CAGGCTTTGGGCCAGGAGACAGG + Intronic
1140281970 16:73563347-73563369 CAGGAGAATGGCGTGGAGGCAGG - Intergenic
1140598173 16:76440904-76440926 CTGGAGAAGGGCTAGGATGCAGG + Intronic
1141604784 16:85146549-85146571 CAGGCTAAGAGCAAGGATGCTGG - Intergenic
1141632505 16:85296056-85296078 CAGGCTGAGAACCAGGAGGCCGG + Intergenic
1203146942 16_KI270728v1_random:1808765-1808787 CAGGGACAGGGCCAGAAGGCAGG + Intergenic
1203151708 16_KI270728v1_random:1846239-1846261 CAGGATCAGGGTCAGGAGCAGGG + Intergenic
1142883184 17:2896732-2896754 TAGGAAAAAGGGCAGGAGGCGGG - Intronic
1143012807 17:3875577-3875599 CAGGAAAGAGGTCAGGAGGCCGG - Intronic
1143177974 17:4967501-4967523 CGGGAGAAGAGGCAGGAGGCTGG + Intronic
1143179206 17:4973750-4973772 CAGGATGAAGGCCAGGGGCCTGG - Exonic
1143429805 17:6872714-6872736 GAGGATAAAGGCCAGGGGGAAGG + Intergenic
1143851885 17:9818956-9818978 CAGGCACAGGGCCAGGAGGATGG - Intronic
1144027884 17:11294427-11294449 CAGGATAAGGGGCAGGGAGAAGG + Intronic
1144826057 17:18106331-18106353 CAGGACACAGGCCAAGAGGCAGG - Intronic
1145212990 17:21028940-21028962 CAGGATCAGGAGCAGGAGGTGGG - Intronic
1146527855 17:33582040-33582062 GAGAATAAGGGTCTGGAGGCAGG - Intronic
1146659953 17:34659051-34659073 CAGGAACAGGCCCAGGATGCTGG + Intergenic
1148396381 17:47311173-47311195 ATGGATGAGGGACAGGAGGCCGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148807599 17:50272172-50272194 CAGGAGGAGGGGGAGGAGGCTGG - Intronic
1148857855 17:50588748-50588770 CAGAGTCAGGGCCAGCAGGCAGG - Intronic
1150107397 17:62472436-62472458 CAGGATAAAAGCCAGGAGGCTGG + Intronic
1150317981 17:64185976-64185998 AAGGGTAAGTGCCAGGTGGCTGG + Intronic
1150343200 17:64385365-64385387 CAGGTTGAGGGCCAGGGGGCTGG - Intronic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1151498326 17:74473117-74473139 AAGGGTAAGGGAAAGGAGGCAGG + Intronic
1151728819 17:75899139-75899161 CTGGGTAAGGGCCATGGGGCTGG - Exonic
1151793517 17:76325696-76325718 CAGGAGAATGGCATGGAGGCAGG - Intronic
1151947425 17:77327298-77327320 CAAGAGACGGGCCAGGAAGCTGG - Intronic
1152093396 17:78258895-78258917 CAGGCTCAGGGCCAAGAGGATGG - Intergenic
1152105773 17:78327983-78328005 GAGGATAAATGCCAGGAGGAAGG + Intergenic
1152317830 17:79591118-79591140 CAGGAGAAGAGCCAGGATGGGGG + Intergenic
1152550220 17:81026039-81026061 CTGGCTAGGGGCTAGGAGGCGGG - Intergenic
1152581589 17:81167742-81167764 CATGATCAGGGCCAGGAAGAAGG - Intergenic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152641557 17:81451540-81451562 CGGGATGAGGGTCAGGAGACCGG - Intronic
1152657674 17:81527536-81527558 GAGGATGAAGGCCAGCAGGCCGG - Intergenic
1152661552 17:81544657-81544679 CAGGCCAAGAGCCAGGAAGCCGG + Intronic
1152680554 17:81665810-81665832 CAGGATCAGGGCCTGGCGCCGGG + Intronic
1152689565 17:81711989-81712011 CAGGTTCAGGGCCAGGGGCCGGG + Intergenic
1156748455 18:40421006-40421028 CAGGAACAGAGGCAGGAGGCTGG - Intergenic
1157279969 18:46340485-46340507 CAGCATAAGCCCCAGGAGGGAGG - Intronic
1157853645 18:51083288-51083310 CAGGAGTAAGGCCAGAAGGCAGG - Exonic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1158279601 18:55808508-55808530 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1158618881 18:59013127-59013149 CGGGAGAAGGGGCAGGAGGGTGG - Intergenic
1159359289 18:67380787-67380809 AAGCATAAAGGCCAGTAGGCAGG + Intergenic
1159954368 18:74508866-74508888 GATGATAAGGGCCCGGTGGCCGG + Exonic
1160053383 18:75456936-75456958 CAGGAAAGGGGTCAGGAGCCAGG - Intergenic
1160251850 18:77210150-77210172 AAGGATAAGGGGTAGGGGGCAGG - Intergenic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1160901424 19:1430497-1430519 CAGGTGAAGGGCCTGGTGGCAGG - Intronic
1162669723 19:12245882-12245904 CAGGAAAACAGGCAGGAGGCCGG - Intronic
1163087988 19:14996707-14996729 CAGGCTAAGAGCCAGGAGAGTGG - Intronic
1163175950 19:15564155-15564177 CAGGACACGGGCCAGGAGCCAGG - Intergenic
1163182748 19:15615699-15615721 CAGGATGCGGGCCAGGAGCCAGG - Exonic
1163186270 19:15641498-15641520 CAGGATGCGGGCCAGGAGCCAGG - Exonic
1163218441 19:15897507-15897529 CAGGACATGGGCCAGGAGCCAGG + Exonic
1163222816 19:15934304-15934326 CAGGACGCGGGCCAGGAGCCAGG + Exonic
1163448176 19:17359951-17359973 CAGGCCAAAGGCCTGGAGGCTGG - Intronic
1163760150 19:19132101-19132123 CAGTAGAAATGCCAGGAGGCAGG - Intronic
1164618440 19:29680278-29680300 CAGGAGCAGGGCCAGCAGGAGGG + Intergenic
1165319291 19:35075772-35075794 CAGGGCAAGCGCCAGGAGCCAGG - Intergenic
1165327228 19:35121170-35121192 CAGGATTACAGCCAGGATGCAGG - Intronic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165795804 19:38518494-38518516 CAGGGTAAGGGGCCAGAGGCTGG + Intronic
1166303647 19:41925875-41925897 ATGGGTGAGGGCCAGGAGGCTGG + Intronic
1166304209 19:41928447-41928469 GAGGAGAAGGCGCAGGAGGCAGG - Intronic
1166734171 19:45075001-45075023 AAGGGCAAGGGCCAGGGGGCTGG + Intronic
1166871323 19:45872764-45872786 CAGGCTCAGGGGCTGGAGGCGGG - Exonic
1167120674 19:47514666-47514688 CAGGCTGAGGGCCAAGAGCCTGG - Intronic
1167347470 19:48955362-48955384 ATGGAGAAAGGCCAGGAGGCTGG - Intronic
1167389455 19:49184570-49184592 CAGGAGAATGGCGTGGAGGCAGG - Intronic
1167714241 19:51130924-51130946 CAGAAGAAGGCCCAGGAGGAGGG - Intronic
1168203793 19:54834888-54834910 GGGGATATGGGCCTGGAGGCTGG + Intronic
1168284127 19:55322037-55322059 AAGGAAAAGGGTCAGGCGGCAGG - Intronic
1168686446 19:58352165-58352187 CAGGACCAGGTCCAGGAAGCTGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925913222 2:8586781-8586803 CAGGACAGGGGCCTGGAGCCAGG + Intergenic
926222361 2:10944645-10944667 CAGGGAAGGGGCCAGGAGGAAGG - Intergenic
926299295 2:11590610-11590632 TAGGATAGGGGCCCGGAGGGTGG - Intronic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
928221695 2:29408467-29408489 CAGGATAGGAGCCAGTGGGCAGG + Intronic
928370612 2:30737492-30737514 CAGGAGGAGGGTCAGGAGTCTGG + Intronic
928432166 2:31229189-31229211 AAGGAGAAGGGGCAGGAGACAGG + Intronic
931432925 2:62223155-62223177 CAGCCTCAGGGCCAGGTGGCCGG - Exonic
932021896 2:68095888-68095910 CAGTCCAAGGGCCAGTAGGCAGG - Intronic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
932580971 2:72992543-72992565 CTGGAAATGGGCGAGGAGGCTGG - Intronic
934818748 2:97353720-97353742 CTGGATATGAGACAGGAGGCTGG + Intergenic
934939273 2:98488781-98488803 CAGGGAAAGGACCAGGAGACTGG + Intronic
935245652 2:101216848-101216870 CAGGAGAATGGCCTGGACGCGGG - Intronic
935351110 2:102152410-102152432 CAGGAGAATGGCCTGGATGCGGG + Intronic
936463810 2:112729672-112729694 CAGGAGAGGAGGCAGGAGGCAGG - Exonic
936548033 2:113409555-113409577 CAGGATGAGGTCCTGGAGCCTGG - Intergenic
936568167 2:113595913-113595935 CAGCACATGGGCCAGGAGCCAGG + Intergenic
937278912 2:120704083-120704105 AAGGATATGGGCCAGGTGGTTGG - Intergenic
937440489 2:121911232-121911254 CAGGATAATGGCAAGGTGGGGGG - Intergenic
937917566 2:127106508-127106530 GAGGCCAAGGGCCGGGAGGCTGG - Intronic
942728849 2:179041181-179041203 CAGGAGAATGGCGTGGAGGCAGG - Intronic
943334750 2:186600143-186600165 CAAGATAAGGTCAAGGAGCCTGG - Intronic
946329422 2:219001216-219001238 CAGGAACCGGGACAGGAGGCTGG + Intergenic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
948097947 2:235351214-235351236 CAGGATAAGTGTGGGGAGGCGGG - Intergenic
948146233 2:235710221-235710243 CAGGACAAGGGCCAGGAGACAGG + Intronic
948562630 2:238864616-238864638 CAGGACAGGGGCCCAGAGGCTGG + Intronic
948815855 2:240510097-240510119 GAAGACAAGGGCAAGGAGGCAGG - Intronic
1169068477 20:2707635-2707657 CAGGACAAAGGTCAGGTGGCTGG - Intronic
1169135038 20:3192088-3192110 CAGGACAGGGCCCATGAGGCAGG - Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1170131346 20:13023201-13023223 CAGGAAAGGGGCCAGGAAGTTGG - Intronic
1170843070 20:19939680-19939702 AAGTACAAAGGCCAGGAGGCAGG - Intronic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1170941855 20:20854621-20854643 CAGGGTCATGGCCAGGATGCTGG - Intergenic
1172814706 20:37677155-37677177 CATGAAAAGGGCCTGCAGGCTGG - Intergenic
1173345117 20:42192245-42192267 CAGGAAAATGGCCAGCTGGCTGG - Intronic
1173551931 20:43938468-43938490 CAGGACATGGGGCAGGAGCCAGG - Intronic
1174147004 20:48459084-48459106 CAGGGGAAGGGCCAGGGGACAGG + Intergenic
1174185064 20:48700733-48700755 CAGGTGAGTGGCCAGGAGGCTGG - Exonic
1175036399 20:56004854-56004876 CAGGATCAGGTCCAGGGCGCCGG + Exonic
1175366471 20:58459704-58459726 TAGGATTATGGCAAGGAGGCTGG + Exonic
1175824080 20:61927299-61927321 CAGGATGCAGGCCAGGTGGCTGG - Intronic
1176857749 21:13985483-13985505 CAGGATCAGGGCCAGGAGGCTGG - Intergenic
1177659296 21:24062414-24062436 CAGGAGAATGGCGTGGAGGCAGG - Intergenic
1178591026 21:33910228-33910250 CAGGATTCTGGCCAGGAGCCTGG - Intronic
1179071305 21:38073627-38073649 CATCAGAAGGGCCAGGAGCCAGG + Intronic
1179415119 21:41192271-41192293 CAGGCTAAGGGAGAGAAGGCAGG + Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180589384 22:16923572-16923594 CAGGATGAGGTCCCGGAGCCTGG + Intergenic
1180705044 22:17804274-17804296 CAGGCTGAGGGCCTGGAGGCAGG + Intronic
1180905836 22:19410655-19410677 CAGGAGAAGAGCAAGGTGGCAGG + Intronic
1181746306 22:24957140-24957162 CAGGATAAGTTCCAGGTGGGTGG + Intronic
1181935275 22:26433809-26433831 CACGAAGAGGACCAGGAGGCAGG - Exonic
1182101885 22:27663228-27663250 CAGGGTGAAGGCCTGGAGGCTGG - Intergenic
1182684929 22:32114814-32114836 CAAGATATGGGTCAGGAAGCAGG - Intergenic
1183079836 22:35449334-35449356 CACGATAGGGGCAAGGAGCCTGG - Intergenic
1183277884 22:36912594-36912616 CAGGAGAAAGGGCAGCAGGCAGG - Intergenic
1183686209 22:39362677-39362699 CAGGACAAGGGCAGGAAGGCTGG + Intronic
1183941748 22:41299733-41299755 AAAGAAAAGGGCCAGGAGGCTGG - Intergenic
1184262814 22:43329123-43329145 CAGGCTAAGGGCAAGGGGCCTGG - Intronic
1184631550 22:45784590-45784612 CGGGAGAAGGGACAGGAGGCTGG + Intronic
1184790493 22:46696766-46696788 CAGGATGAGAGCCCCGAGGCAGG - Intronic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950579246 3:13852034-13852056 CAGGATGTGGGCCATGGGGCAGG - Intronic
950640003 3:14342591-14342613 CTGGAGAGGTGCCAGGAGGCAGG + Intergenic
951086863 3:18521852-18521874 CAGGAGAAAGGCTGGGAGGCTGG - Intergenic
951937844 3:28041726-28041748 CAGGATAAAGACTAGGAGTCTGG + Intergenic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954155107 3:48681073-48681095 CTGGACAAGGGCCACAAGGCAGG - Intronic
954218223 3:49136159-49136181 CAGGTGAAGGGCCAGGAGGCTGG - Intergenic
954924998 3:54226292-54226314 AAGCATCAGGGGCAGGAGGCGGG - Intronic
955338260 3:58104803-58104825 AAGGTAAAGGGCCAGGAGGCTGG + Intronic
956678173 3:71754258-71754280 CAGCATGACGGCCGGGAGGCAGG - Exonic
956734924 3:72231143-72231165 CAGGAAAGGGGCCAAGATGCAGG - Intergenic
958709571 3:97700963-97700985 CAGGCCAAAGTCCAGGAGGCAGG + Intronic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960209097 3:114938004-114938026 CAGGAGAATGGCGTGGAGGCAGG + Intronic
961470447 3:127107941-127107963 CAGGAAAAGGCCCAGGAGCCAGG - Intergenic
961550391 3:127667570-127667592 CAGGATGTGAACCAGGAGGCAGG + Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
962090889 3:132243003-132243025 CAGGATACGGGGTAGGAGGAGGG - Intronic
962316249 3:134361279-134361301 CTGGACATGGGCCAGGTGGCAGG + Intronic
962714413 3:138114754-138114776 CAGGACAGGGATCAGGAGGCAGG - Intronic
963280090 3:143375915-143375937 CAAGACAAGGGCCCTGAGGCAGG - Intronic
964542000 3:157789865-157789887 CAAGATCTGGGCCAGGAGCCTGG + Intergenic
966470488 3:180283402-180283424 CAGGATCAGGGCAAGGAGGAGGG + Intergenic
966816355 3:183893088-183893110 CAGGATCAAAGACAGGAGGCTGG + Intergenic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
967829805 3:193909297-193909319 CAGGAGCTGGGGCAGGAGGCAGG + Intergenic
967838651 3:193985812-193985834 CAGGAGAATGGCGTGGAGGCAGG - Intergenic
968227676 3:196985341-196985363 CAGGAGAAGGGCCTTGAGGCTGG + Intergenic
968386513 4:143969-143991 CAGGAAAACGGTCTGGAGGCAGG + Intronic
968491442 4:892579-892601 CAGCATCAGGGCCTGGGGGCTGG - Intronic
968773742 4:2526031-2526053 CAGGAGAATGGCATGGAGGCAGG + Intronic
968809233 4:2792683-2792705 CAGGATCAGGACCACGGGGCTGG + Intergenic
969383113 4:6820588-6820610 TAGGATAAAGGCCAGGAGTGGGG - Intronic
970585762 4:17512330-17512352 CGGGCTAAGGGCGAGGAGGGTGG + Intergenic
977711911 4:100135997-100136019 CATGGTAAAGGGCAGGAGGCAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
982407203 4:155033797-155033819 GAGGATAGTGGCCAGCAGGCGGG - Intergenic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984873061 4:184344384-184344406 GAGGATAAGAGGCAGGAGACCGG - Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985779851 5:1864829-1864851 CAGGGTCAGAGCCAGGAGGAGGG - Intergenic
986298780 5:6462023-6462045 CATGATGAAGGCCAGTAGGCTGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987885476 5:23806768-23806790 CAGGATGAGGGAGAGAAGGCAGG - Intergenic
989145377 5:38244535-38244557 CAGGATAATCGCTTGGAGGCAGG - Intergenic
989624516 5:43416472-43416494 GAAGATAAGAGTCAGGAGGCTGG + Intergenic
989984685 5:50684801-50684823 CAGGGAAAGGGACATGAGGCAGG - Intronic
989997757 5:50855847-50855869 CAGCCTAAAGGCCAGGATGCTGG + Intergenic
990466170 5:56073914-56073936 CAGGGTATGCACCAGGAGGCTGG + Intergenic
991565041 5:67996645-67996667 GAGCAGAATGGCCAGGAGGCCGG - Intergenic
992672073 5:79070415-79070437 CAGGAAAGGGGCCAGGAGCTGGG - Intronic
993367438 5:87050693-87050715 CAGGCTAGGGGAGAGGAGGCAGG + Intergenic
995083491 5:108081423-108081445 TAAGATAAGAGCCAGTAGGCCGG + Intronic
995182170 5:109239423-109239445 AAGCATGAGGGCCAGGAGCCTGG + Intergenic
996759651 5:126974295-126974317 AAGGATGGGGGCCAGGAGCCTGG - Intronic
999380416 5:151117529-151117551 CAGGACAAGGGCCACCAGGGAGG + Intronic
1000039197 5:157472536-157472558 CAGGATGAGGGACAGGATGTAGG - Exonic
1000616621 5:163434781-163434803 CAGAATAATGGCCTTGAGGCTGG - Intergenic
1001238836 5:170052437-170052459 CTGGTTCAGTGCCAGGAGGCAGG + Intronic
1001330757 5:170760746-170760768 TAGGAGAAGGTCCAGGAGCCTGG - Intergenic
1001542290 5:172548035-172548057 CACGTTAAGTGCCAGGAGGAAGG - Intergenic
1002783919 6:386902-386924 GAGAACAATGGCCAGGAGGCCGG - Intergenic
1003403344 6:5808919-5808941 CAGGACATAGGCCAGGAAGCTGG + Intergenic
1003806102 6:9727429-9727451 CAGTGAAAGGGCCAGGAGGTCGG - Intronic
1003833770 6:10044276-10044298 CAGGACAAGGGCCATGGTGCAGG - Intronic
1003874337 6:10423012-10423034 CAGGGTCAGGGCCAGGAAGAAGG + Intergenic
1004003687 6:11619868-11619890 CAGGAGAAGGGCCAGATGGCTGG + Intergenic
1005473279 6:26182894-26182916 GAGGAGAAGGGCTAGGGGGCTGG + Intergenic
1006402221 6:33824585-33824607 CGTGCTTAGGGCCAGGAGGCTGG + Intergenic
1006454259 6:34122964-34122986 CCCGAGCAGGGCCAGGAGGCAGG + Intronic
1007323555 6:41043614-41043636 CAGCATAGAGGCCAAGAGGCAGG - Exonic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007586341 6:42992353-42992375 CAAGAAAAGGGCAAGGGGGCCGG - Intronic
1007720666 6:43883616-43883638 CAACACAAGGGCCTGGAGGCAGG - Intergenic
1007927838 6:45663937-45663959 CATGTGAAGGGCCAGGAAGCCGG - Intronic
1008526101 6:52408686-52408708 CAGCCTGAGGGCCAGGAGGCTGG + Intergenic
1009973608 6:70650793-70650815 CAGGATAAAGCACAGGAGTCTGG + Intergenic
1011493941 6:87920525-87920547 TAGGATCAGGGCCAGGAGGAAGG - Intergenic
1011700426 6:89950265-89950287 CAGGACAGGGGCCAGGAGGTAGG - Exonic
1012520170 6:100111800-100111822 CAGGATATGGGCCAGGAGGCTGG + Intergenic
1014103156 6:117533810-117533832 CATGCTCACGGCCAGGAGGCTGG + Intronic
1016293279 6:142546991-142547013 CAAGAAAAGAGCCAGTAGGCAGG - Intergenic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1017007687 6:150039640-150039662 CAGGAGGAGGGACAGGAGGTGGG - Intergenic
1017984089 6:159427270-159427292 GAGGCTAAGGGCCTGGAAGCTGG - Intergenic
1018784016 6:167093945-167093967 CAGGATACGGCCCTCGAGGCGGG - Intergenic
1018800239 6:167216594-167216616 CGGGATCAAGGCCTGGAGGCTGG - Intergenic
1018847463 6:167565576-167565598 CAGGATGAGGGGCAGGCGGGTGG - Intergenic
1019325487 7:436352-436374 CAGAATGAGGGCCAAGGGGCGGG + Intergenic
1019381467 7:726511-726533 CAGGACAAGGCCCAGCAGGCAGG + Intronic
1019402986 7:866811-866833 CAGCAGAAGGTCCAGGAGACGGG - Intronic
1019652903 7:2170224-2170246 CTTGTTAATGGCCAGGAGGCAGG - Intronic
1022570841 7:31452705-31452727 CTGGAAAATGGCCAGGAGCCTGG + Intergenic
1024212103 7:47215261-47215283 CAAGATCTGGGGCAGGAGGCTGG - Intergenic
1024698641 7:51883403-51883425 CAGGAGCAGGGGTAGGAGGCAGG - Intergenic
1025744400 7:64230235-64230257 TAAGAAAAGGGCCAAGAGGCCGG + Intronic
1026658727 7:72279867-72279889 CAGAATTAGGGCCAACAGGCAGG + Intronic
1027171765 7:75877952-75877974 GAAGAAAAGGGGCAGGAGGCTGG - Intronic
1028379166 7:90178721-90178743 CAGAACAAGGGCTGGGAGGCAGG + Intronic
1029363879 7:100105237-100105259 CAGGTTATGGGCCAGGAATCCGG + Exonic
1032036443 7:128524972-128524994 CAGGATAAAAGCCAGGAGGCCGG + Intergenic
1032268239 7:130383135-130383157 CAGGGGAAGGGCCAGGGGCCTGG + Intronic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1033043544 7:137940037-137940059 AAGGATAAGGGACAGAAGGAGGG - Intronic
1033619502 7:143049461-143049483 GAGGGGAAGGGCCAGGAGACAGG + Intergenic
1034168772 7:149046441-149046463 AAGAATTATGGCCAGGAGGCCGG - Intergenic
1036383128 8:8252453-8252475 GAGGAAGAGGGCGAGGAGGCAGG - Intergenic
1036452416 8:8880563-8880585 TGGGAGAAGGGCGAGGAGGCAGG - Intronic
1036933056 8:12974737-12974759 CATGAAAAGGGACAGGAGGCGGG + Intronic
1037542937 8:19889536-19889558 TAGGATGAGGATCAGGAGGCTGG + Intergenic
1037677797 8:21066861-21066883 CTGGCTAAGGGCCTGGGGGCAGG - Intergenic
1037715559 8:21394586-21394608 CTGGAAGAGGGACAGGAGGCAGG - Intergenic
1037739855 8:21599812-21599834 CAGGAGAAGGGGTAGGAGGAAGG + Intergenic
1037825896 8:22160316-22160338 CATGTTAAAGGACAGGAGGCTGG + Intronic
1037900012 8:22682615-22682637 CATGATAAGGATCAGGAAGCAGG + Intergenic
1037929437 8:22869088-22869110 CAGTACAAAGGCCATGAGGCAGG - Intronic
1038704837 8:29883981-29884003 CAGGGGTAGGGCCTGGAGGCAGG + Intergenic
1040911975 8:52528685-52528707 CAGGCTAAGGGAGAGAAGGCAGG - Intergenic
1041124580 8:54622121-54622143 CAGGATCACTGCCTGGAGGCTGG - Exonic
1043916050 8:85923278-85923300 CATGATCAGGGACATGAGGCTGG - Intergenic
1046475469 8:114736953-114736975 CAGGAGAAAGGGCGGGAGGCAGG - Intergenic
1047187220 8:122644888-122644910 CAATAAAAGGCCCAGGAGGCAGG + Intergenic
1047435594 8:124833336-124833358 GAGGATAGGGGCCAGGATGGTGG + Intergenic
1047470251 8:125164108-125164130 CAGTCAAAGGGCCAGGAGACTGG - Intronic
1048302631 8:133262679-133262701 GAGGAAAAGGGACAGGAGGTAGG - Intronic
1048888125 8:138924804-138924826 GAGAATAGGGGCCTGGAGGCAGG + Intergenic
1049019870 8:139948678-139948700 CAGGATTGGGGCTAGGAGCCAGG + Intronic
1049477973 8:142805702-142805724 CTGAAAAGGGGCCAGGAGGCAGG - Intergenic
1049617460 8:143581918-143581940 AGTGTTAAGGGCCAGGAGGCTGG - Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049700555 8:144009634-144009656 AAGGAGATGAGCCAGGAGGCAGG - Intronic
1052900655 9:33791944-33791966 CAAGAGGAGGGGCAGGAGGCAGG + Intronic
1053105730 9:35406323-35406345 CAGGATAGGGGCAAGGGGGGCGG - Intergenic
1054302958 9:63391084-63391106 CAGGATCAGGGTCAGGAGCAGGG - Intergenic
1056801100 9:89692357-89692379 GAGGCTATGGGCCTGGAGGCTGG + Intergenic
1057447624 9:95128835-95128857 CAGGTAAGAGGCCAGGAGGCAGG + Intronic
1057817904 9:98309108-98309130 AACCTTAAGGGCCAGGAGGCTGG + Intronic
1057842328 9:98496015-98496037 CCGGATAGGGGTCAGGAGCCTGG + Intronic
1057857049 9:98609842-98609864 CAGGCTCAGGGCCAGGACACTGG + Intronic
1060228067 9:121808288-121808310 CAGCAGTAGGGCCAGGAGGGAGG - Intergenic
1061012335 9:127963064-127963086 AGGGATAATGGCCAGAAGGCAGG + Intronic
1061364074 9:130161754-130161776 CAGGAGAATGGCCAGGACCCAGG + Intergenic
1061368614 9:130185593-130185615 CAGGAGCAGGGCCGGGAGGAGGG - Intronic
1061423198 9:130483422-130483444 CAGGGTCAGGGACAGGGGGCTGG + Intronic
1061486181 9:130921583-130921605 CAGGATTTGGGCTGGGAGGCCGG - Intronic
1061651032 9:132050159-132050181 CAGGAGAAGGGACAGTAAGCAGG + Intronic
1061661279 9:132132007-132132029 AAGGAACAGAGCCAGGAGGCTGG - Intergenic
1061936206 9:133858971-133858993 CAGGACCAGGGCCAGCAAGCAGG + Intronic
1062370436 9:136236041-136236063 CAGGGTCAGGGCCAGGATGGGGG + Intronic
1062655574 9:137603066-137603088 TAGGATATAGGGCAGGAGGCTGG + Intergenic
1185463147 X:341515-341537 CAGGAGGAGGGGCAGGAGGGGGG - Intronic
1186826579 X:13346434-13346456 CAGGATAAAGGGGAGGAAGCAGG + Intergenic
1189295535 X:39915039-39915061 CAGCTTGAGTGCCAGGAGGCAGG + Intergenic
1189325345 X:40108103-40108125 CAGGTTGAGGGCCAGGCGGGAGG + Intronic
1189942420 X:46138480-46138502 CAGGACAAGGTCAAGGAGGCAGG - Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1191254250 X:58273001-58273023 CAGGAGTAGGTTCAGGAGGCCGG - Intergenic
1191909764 X:66136887-66136909 AAGGAGAAGGACTAGGAGGCTGG - Intergenic
1192372472 X:70525966-70525988 CAGGGTCAGGGCCTGGTGGCAGG + Intergenic
1196462573 X:115945297-115945319 CAGGAGAACGGCCAGAAGCCAGG + Intergenic
1196730202 X:118933908-118933930 CAGCATAAAGGCCAGGAGAGAGG - Intergenic
1197714426 X:129696141-129696163 CAGGACAAAGGCCAGGAGCAAGG + Intergenic
1198887274 X:141353351-141353373 CTTGATCAGGGCCAGGAGGCTGG + Intergenic
1199447108 X:147938247-147938269 CAGGATTAGGGACTGGAGGGAGG + Intronic
1199847517 X:151701710-151701732 AAGGATGAGGGCCAGAGGGCTGG + Exonic
1201190395 Y:11438827-11438849 CAGGACCAGGGTCAGGAGGAGGG - Intergenic
1201234399 Y:11895613-11895635 CAGGCTAAGGGCAAAGAGGGAGG + Intergenic
1202258391 Y:22943690-22943712 CACGGAAAGGGCCAGGAGGTTGG - Intergenic
1202411381 Y:24577448-24577470 CACGGAAAGGGCCAGGAGGTTGG - Intergenic