ID: 907403219

View in Genome Browser
Species Human (GRCh38)
Location 1:54238477-54238499
Sequence CAGGGGGCGTTGCCCGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907403219_907403232 30 Left 907403219 1:54238477-54238499 CCGACCTCGGGCAACGCCCCCTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 907403232 1:54238530-54238552 AAGTCCCATCCAGTGGGTGCAGG 0: 1
1: 0
2: 2
3: 18
4: 676
907403219_907403224 -9 Left 907403219 1:54238477-54238499 CCGACCTCGGGCAACGCCCCCTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 907403224 1:54238491-54238513 CGCCCCCTGGGTGAGGAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 156
907403219_907403229 23 Left 907403219 1:54238477-54238499 CCGACCTCGGGCAACGCCCCCTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 907403229 1:54238523-54238545 ACTAACCAAGTCCCATCCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 60
907403219_907403230 24 Left 907403219 1:54238477-54238499 CCGACCTCGGGCAACGCCCCCTG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 907403230 1:54238524-54238546 CTAACCAAGTCCCATCCAGTGGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907403219 Original CRISPR CAGGGGGCGTTGCCCGAGGT CGG (reversed) Intronic
900127042 1:1073286-1073308 CAGGGGTCAGTGCCCGAGGAAGG + Intronic
900935785 1:5765604-5765626 CAGGTCCCGTTGCCAGAGGTGGG - Intergenic
907403219 1:54238477-54238499 CAGGGGGCGTTGCCCGAGGTCGG - Intronic
917817675 1:178726057-178726079 CAGGGGCCGCAGCCCCAGGTCGG + Intronic
919791293 1:201292518-201292540 CAGGGGAGGTGGCACGAGGTGGG + Intronic
1065134692 10:22656256-22656278 GAGGGGCCGGTGCCCCAGGTGGG - Intronic
1069880264 10:71588260-71588282 CAGGGTGCCTTGCCCGTGGCAGG - Intronic
1071529784 10:86380434-86380456 CAGGGGGCATTGCCTGGGGCCGG - Intergenic
1074768830 10:116720246-116720268 GAGGGGGCGGTGCCCAGGGTGGG - Intronic
1074824595 10:117205629-117205651 AAGGGGGCTTTGGCTGAGGTGGG - Intronic
1075717576 10:124565977-124565999 CAGAGGGCCTTTGCCGAGGTGGG + Intronic
1075812230 10:125232574-125232596 CATGGGGCATTGGCCCAGGTAGG - Intergenic
1077222007 11:1422005-1422027 CAGGGGGTCTAGCCTGAGGTTGG + Intronic
1077420531 11:2447901-2447923 GAGGGGGGGTTCCCCGAGGAGGG - Intronic
1080520186 11:33061709-33061731 CAGAGGCCGTTCCCCGAAGTAGG + Exonic
1084621425 11:70272365-70272387 CAGGGGAAGTTACACGAGGTTGG + Exonic
1092659558 12:10723232-10723254 CAGGCGGCGGCGGCCGAGGTGGG + Exonic
1102573245 12:113840448-113840470 CAGGGCATGTTGCCAGAGGTAGG - Intronic
1104761337 12:131299053-131299075 CAGGGAGCGCAGCCCCAGGTGGG + Intergenic
1104818438 12:131661739-131661761 CAGGGAGCGCAGCCCCAGGTGGG - Intergenic
1105935659 13:25096106-25096128 CCGGGGGCGTAGCCGGAGGGAGG - Exonic
1106466669 13:30019917-30019939 CAGGGGGAATTGCCCGGGGTGGG + Intergenic
1122636053 14:103130213-103130235 CAGAGGGGGTGCCCCGAGGTGGG - Intronic
1122860017 14:104578314-104578336 CAGGCTGCACTGCCCGAGGTCGG - Intronic
1125357080 15:38827680-38827702 CAGAGGGGGTTGCCGGAGGAAGG + Intergenic
1130106367 15:80931691-80931713 CAGGGGGAGTTTCTAGAGGTGGG + Intronic
1132466954 16:81879-81901 CAGGAGGCCTTCCCGGAGGTAGG - Intronic
1132467007 16:82050-82072 CAGGAGGCCTTCCCGGAGGTAGG - Intronic
1133033172 16:3021205-3021227 CAGGGGGCGGTGCCTGGGGAGGG - Exonic
1133771443 16:8869024-8869046 GAGGGGGCGTGGCCCGAGGGGGG + Intergenic
1135014524 16:18913936-18913958 CAGGGGGCATCACCTGAGGTCGG + Intronic
1141132399 16:81445076-81445098 GAGGGGGCGCTGCCCGCGGGGGG - Intergenic
1142200157 16:88757303-88757325 CAGGGGGCGTTGCTGGCGGGGGG + Intronic
1142409997 16:89911077-89911099 CAGGGGGAGAGGCCCGAGGAAGG + Exonic
1142862105 17:2768744-2768766 CAGGAGGGGTTGGCCAAGGTAGG + Intergenic
1147015288 17:37487382-37487404 CAGGGGGCATCACCTGAGGTCGG + Intergenic
1149654328 17:58302371-58302393 CTGGGGGCGCTGCCAGAGCTGGG + Exonic
1149664884 17:58358452-58358474 CAGGGGGCCTGGCCCGGCGTAGG + Exonic
1152649989 17:81488289-81488311 TGGGGGGCTTTTCCCGAGGTCGG + Intergenic
1152720989 17:81923791-81923813 CAGGGGGCTTTGTCCGAGGCCGG - Intronic
1157594578 18:48856726-48856748 CGGGGGGAGTTGCCAGAGGCTGG + Intronic
1159644493 18:70901284-70901306 CATGGGGCTTTGCACGAGGATGG + Intergenic
1159920276 18:74221387-74221409 CAGGGGGTGCTGCCTGAGTTGGG + Intergenic
1160756000 19:757468-757490 CCAGGGGCGTGGACCGAGGTGGG - Exonic
1160991773 19:1863148-1863170 CCGGGGGCGCGGCCCGAGGACGG + Exonic
1162094988 19:8304978-8305000 CAGGGGGCGGGGCCTGAGGGTGG - Intronic
1163848400 19:19650221-19650243 TAGGGGGCCTTGCATGAGGTGGG - Intronic
1165394800 19:35558305-35558327 CCTGGGGCGGGGCCCGAGGTGGG + Intronic
1166702047 19:44887904-44887926 CAGGGTGAGTTGCACGAGCTGGG + Intronic
1166995270 19:46716994-46717016 AAGGGGGCGTTGCCGGAGCGGGG + Exonic
1167445357 19:49534116-49534138 CAGGGGGCGTGGCCCGTGCGAGG + Intronic
1168062096 19:53898769-53898791 CAGGGGGCGTGGCCGGGGGGGGG + Intronic
1168287382 19:55341369-55341391 CAGGGGGCGGAGACCGAGGCTGG + Intronic
1168311067 19:55461130-55461152 AAGGGGGCGTGGCTGGAGGTGGG + Intronic
1168508974 19:56959437-56959459 CAGGGTGAGTTGCCCGGGGGAGG + Intergenic
926123425 2:10256958-10256980 CAGGGGGCGCTGCGTGAGGGAGG - Intergenic
926350969 2:11994179-11994201 CAGAGGGCGTTCCAGGAGGTGGG + Intergenic
938669725 2:133575079-133575101 CAGTGGGCTTTGCCTGAGTTTGG - Intergenic
942483698 2:176417302-176417324 CAGGTGGTGTTGCCTGAGCTAGG - Intergenic
945609750 2:211984976-211984998 CAGGCGCCGTGGGCCGAGGTGGG - Intronic
946171511 2:217898609-217898631 CAGTGGGAGCTGCCAGAGGTGGG - Intronic
947794714 2:232887006-232887028 CAGGAGGAGTGGCCCGAGGTGGG + Intronic
948270237 2:236668590-236668612 CAGGGGCAGTTTCCCCAGGTGGG - Intergenic
1170029287 20:11928032-11928054 CAGGGGGAGATGCCCAAGTTCGG - Intergenic
1179522475 21:41954038-41954060 GCGGGGGCGGTGCCCGAGGGAGG + Intergenic
1179612335 21:42560338-42560360 CAGGGGGCGCTGTCCAGGGTGGG + Intronic
1179932670 21:44580472-44580494 CAGGGGGCGGTGCCGCAGGGGGG + Exonic
1180599756 22:17008154-17008176 GAGAGGGCGTTGCTGGAGGTGGG + Exonic
1182756995 22:32688396-32688418 CAGGAAGTCTTGCCCGAGGTGGG + Intronic
960602223 3:119469360-119469382 CAGGAGGCGTGGCCCGTGCTTGG + Intronic
962268207 3:133958425-133958447 CCGGGGCTGTTGCCCCAGGTGGG + Intronic
969472132 4:7395152-7395174 GAGGGGCTGTTGCCCGAGATGGG - Intronic
969846735 4:9925390-9925412 CAGGGGGCGCTCCCAGGGGTGGG - Intronic
978485942 4:109253481-109253503 CAGGTGGCCTTCCCCGATGTGGG - Intronic
985513487 5:325139-325161 CAGGGGATGTTGTCAGAGGTGGG - Intronic
1001594429 5:172888769-172888791 CAGAGGGCATGGCCAGAGGTTGG - Intronic
1002445082 5:179285688-179285710 CTGGGGACGTTCCCCGACGTGGG - Intronic
1003544896 6:7051425-7051447 CAGGCGGCGTCCCCCGAGGGCGG + Intergenic
1007077269 6:39075695-39075717 CAGGAGGCCTTGCCCAAGCTGGG + Intronic
1007191207 6:40020447-40020469 CATGGGGCTCTGCCCCAGGTAGG + Intergenic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1010037569 6:71344010-71344032 CAGGTGGGGTTGCCAGAGGCAGG - Intergenic
1018952129 6:168386093-168386115 CTGGAGGCCTTGGCCGAGGTGGG + Intergenic
1019303679 7:322354-322376 CGGGGGGCGTGGCCGGGGGTTGG - Intergenic
1022279710 7:28894909-28894931 CATGTGCAGTTGCCCGAGGTTGG - Intergenic
1023750144 7:43364564-43364586 GAGGGGGCGTGGCCTGAGGCAGG + Intronic
1029110262 7:98210544-98210566 CTGGGGGCGGAGCCCGAGTTGGG - Intergenic
1029376018 7:100177393-100177415 CAGGGGGCGGGGCCCGAGGCGGG + Intergenic
1029611285 7:101627845-101627867 CAGGGAGTGTTGCCCAGGGTGGG + Intronic
1035404281 7:158587884-158587906 CCGGGGGCGTGGCCTGAGGGCGG - Intergenic
1038798244 8:30727872-30727894 CCGGGGGCGGTCCCCGGGGTAGG + Exonic
1043889523 8:85641073-85641095 GACGGGTGGTTGCCCGAGGTAGG + Intergenic
1044539387 8:93392562-93392584 CAGGGGGCAGTGCACGAAGTGGG - Intergenic
1044604157 8:94034350-94034372 CAGTGGGCGTTGTAGGAGGTGGG - Intergenic
1049618587 8:143587782-143587804 CAGTGGGAGTGGCACGAGGTGGG - Intronic
1049848916 8:144820430-144820452 CAGTGGGCATTGCCCCAGGGAGG - Intergenic
1052917110 9:33931839-33931861 CAGGAGGTGTTGGGCGAGGTTGG - Intronic
1053159037 9:35800784-35800806 CAGGGGGGATTGTCCGAGGGAGG - Exonic
1061484193 9:130912024-130912046 CAGGGGCCGTTGCGGGAAGTGGG - Intronic
1196921520 X:120590580-120590602 CAGGGGGTTTTGCCTGAGGGTGG + Intergenic