ID: 907404453

View in Genome Browser
Species Human (GRCh38)
Location 1:54245371-54245393
Sequence GCATACAGAATCTGGGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907404453_907404460 -4 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404460 1:54245390-54245412 ATGCTTAGCCAAGAAACTGGCGG 0: 1
1: 0
2: 5
3: 14
4: 152
907404453_907404466 7 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404466 1:54245401-54245423 AGAAACTGGCGGGAGGCGGGTGG No data
907404453_907404467 8 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404467 1:54245402-54245424 GAAACTGGCGGGAGGCGGGTGGG 0: 1
1: 0
2: 1
3: 19
4: 262
907404453_907404459 -7 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404459 1:54245387-54245409 TGTATGCTTAGCCAAGAAACTGG No data
907404453_907404468 12 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404468 1:54245406-54245428 CTGGCGGGAGGCGGGTGGGAAGG No data
907404453_907404473 25 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404473 1:54245419-54245441 GGTGGGAAGGGGGACAGAATGGG 0: 1
1: 0
2: 8
3: 57
4: 650
907404453_907404470 14 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404470 1:54245408-54245430 GGCGGGAGGCGGGTGGGAAGGGG 0: 1
1: 1
2: 16
3: 187
4: 1770
907404453_907404463 3 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404463 1:54245397-54245419 GCCAAGAAACTGGCGGGAGGCGG 0: 1
1: 0
2: 1
3: 15
4: 210
907404453_907404461 -3 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404461 1:54245391-54245413 TGCTTAGCCAAGAAACTGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 112
907404453_907404462 0 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404462 1:54245394-54245416 TTAGCCAAGAAACTGGCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 69
907404453_907404472 24 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404472 1:54245418-54245440 GGGTGGGAAGGGGGACAGAATGG 0: 1
1: 1
2: 14
3: 164
4: 1429
907404453_907404465 4 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404465 1:54245398-54245420 CCAAGAAACTGGCGGGAGGCGGG 0: 1
1: 0
2: 3
3: 29
4: 177
907404453_907404469 13 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404469 1:54245407-54245429 TGGCGGGAGGCGGGTGGGAAGGG 0: 1
1: 1
2: 5
3: 69
4: 738
907404453_907404471 15 Left 907404453 1:54245371-54245393 CCGGCCCCCCAGATTCTGTATGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 907404471 1:54245409-54245431 GCGGGAGGCGGGTGGGAAGGGGG 0: 1
1: 2
2: 11
3: 158
4: 1587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907404453 Original CRISPR GCATACAGAATCTGGGGGGC CGG (reversed) Intronic