ID: 907407107

View in Genome Browser
Species Human (GRCh38)
Location 1:54260395-54260417
Sequence CAGTGGTCAGGGAGGGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907407095_907407107 -4 Left 907407095 1:54260376-54260398 CCCCTCACACCTGTGTGCCCAGT 0: 1
1: 0
2: 4
3: 36
4: 332
Right 907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG No data
907407097_907407107 -6 Left 907407097 1:54260378-54260400 CCTCACACCTGTGTGCCCAGTGG 0: 1
1: 0
2: 3
3: 33
4: 352
Right 907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG No data
907407096_907407107 -5 Left 907407096 1:54260377-54260399 CCCTCACACCTGTGTGCCCAGTG 0: 1
1: 0
2: 1
3: 30
4: 284
Right 907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG No data
907407092_907407107 27 Left 907407092 1:54260345-54260367 CCTCAGGGCGAGCAGTGGGGCTC 0: 1
1: 0
2: 0
3: 19
4: 189
Right 907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907407107 Original CRISPR CAGTGGTCAGGGAGGGCAGG AGG Intronic
No off target data available for this crispr