ID: 907407924

View in Genome Browser
Species Human (GRCh38)
Location 1:54265152-54265174
Sequence CACCCACAGCCCCCAAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907407920_907407924 3 Left 907407920 1:54265126-54265148 CCGGAATCTGTCACCATGGTCTG 0: 1
1: 0
2: 1
3: 19
4: 160
Right 907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG 0: 1
1: 0
2: 1
3: 47
4: 361
907407918_907407924 13 Left 907407918 1:54265116-54265138 CCATGGACATCCGGAATCTGTCA No data
Right 907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG 0: 1
1: 0
2: 1
3: 47
4: 361
907407921_907407924 -10 Left 907407921 1:54265139-54265161 CCATGGTCTGCCTCACCCACAGC 0: 1
1: 1
2: 3
3: 38
4: 409
Right 907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG 0: 1
1: 0
2: 1
3: 47
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907407924 Original CRISPR CACCCACAGCCCCCAAGGAA AGG Intronic
900120744 1:1047707-1047729 CACCCATTGCCTCCCAGGAAGGG - Intronic
900246715 1:1639702-1639724 CGCCCACAGGCACCAAGGAGGGG + Intronic
900257936 1:1706834-1706856 CGCCCACAGGCACCAAGGAGGGG + Intronic
900390973 1:2433775-2433797 CACCCAAAGCCACGAAGGAGCGG - Intronic
900422334 1:2560998-2561020 CACCCACAGCCCCAGGGGACAGG - Intronic
900734601 1:4289937-4289959 CACCCACAGACTCAAAGTAAAGG - Intergenic
901232926 1:7651269-7651291 CCCCCACAGCCCTCCAGAAAAGG + Intronic
902400428 1:16154209-16154231 CAACCACAGTCCCCCAGGAAGGG + Intronic
902639270 1:17756146-17756168 CTCCCAGAGCTACCAAGGAAGGG - Intronic
902644082 1:17786047-17786069 CACCTGCAGCACCCAAGGACAGG - Intronic
903061487 1:20671837-20671859 CACCCACAGCCTGCAAGGAGAGG + Intronic
903231391 1:21924454-21924476 CACCCTCAGGCCCCAGAGAATGG + Intronic
904884518 1:33726267-33726289 CCTCCCCAGCCCCCAAGGAGGGG - Intronic
905641229 1:39591336-39591358 AACTCACAGACGCCAAGGAAGGG - Intergenic
906979924 1:50619104-50619126 CACCCACAGTCTCAAAGTAAAGG - Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
907920428 1:58906301-58906323 CACCCCCAGCCCCCACTGATGGG + Intergenic
908456656 1:64310733-64310755 GACACACAGCCACCAATGAAAGG - Intergenic
909703728 1:78555531-78555553 CACCCACAGACTCAAAGTAAAGG + Intergenic
910064659 1:83139207-83139229 CACCCACAGACTCAAAGTAAAGG - Intergenic
910513170 1:88028563-88028585 CACCCACAGGCTCAAAGTAAAGG - Intergenic
913196089 1:116457429-116457451 CAGCTACAACCCCCATGGAAAGG - Intergenic
914718286 1:150268931-150268953 CACCCCCAGACCCCGGGGAAGGG + Exonic
915535792 1:156534601-156534623 GAGCCACAGCCCCCAGGGCATGG + Exonic
915565600 1:156711038-156711060 GACTCACTGGCCCCAAGGAAAGG - Intergenic
915661885 1:157411557-157411579 CATCCTCAGCCCCCACGGTAGGG - Intergenic
916314463 1:163433387-163433409 CACAGACAGCACTCAAGGAATGG + Intergenic
916863944 1:168836462-168836484 TTCCCACAGCCACCAAGGAAAGG + Intergenic
918056504 1:181026098-181026120 CCTCCACTGCCCACAAGGAAAGG + Intergenic
918633699 1:186749267-186749289 CACAAACACCCCCCAAAGAAAGG - Intergenic
920374996 1:205503583-205503605 AACTCACAGTCCCCAGGGAAAGG + Intergenic
920504197 1:206505282-206505304 CACCCACTGCACTCCAGGAAGGG + Intergenic
920794614 1:209126893-209126915 AACACACAGGCACCAAGGAAAGG + Intergenic
921236956 1:213142241-213142263 CACCCACAGGCTCAAAGTAAAGG - Intronic
922748468 1:228060040-228060062 GAGCCACAGCCCCCGTGGAAGGG - Exonic
922778703 1:228232496-228232518 CACACACAGGCCCCAAAGACAGG - Intronic
922822737 1:228495115-228495137 TCCCCCCAGGCCCCAAGGAAAGG - Exonic
923374006 1:233341718-233341740 CACACCCAGACCCCAAGTAAGGG - Intronic
1065428247 10:25628061-25628083 CACCAACAGGCCCAAAGTAAGGG - Intergenic
1066448759 10:35509269-35509291 TACCCCCAGCCCCCAAAAAAGGG - Intronic
1067519875 10:46991297-46991319 CACCCACAGGCTCAAAGTAAAGG - Intronic
1067642374 10:48060545-48060567 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1068071227 10:52198794-52198816 CACTCACACCCCAAAAGGAAAGG - Intronic
1068266698 10:54658913-54658935 TATCCACAGCCCCAAAGTAAAGG + Intronic
1068832944 10:61518830-61518852 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1069484512 10:68812906-68812928 CACCCACATCTCACAAGTAAAGG - Intergenic
1069918084 10:71799320-71799342 TGCCCAAAGACCCCAAGGAATGG - Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070159974 10:73860462-73860484 CATCCACAGCCCTCATGCAAGGG - Intronic
1070648976 10:78221448-78221470 CACACACATGCCCCAAGGAAGGG - Intergenic
1071022896 10:81080329-81080351 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1072492412 10:95920781-95920803 AACCCACTGCCCTGAAGGAAAGG - Intronic
1072534753 10:96353641-96353663 CACCCCCACTCCCCAAGAAATGG + Intronic
1073072909 10:100806082-100806104 CACCCCCTGCCCCCAAGCCAGGG - Intronic
1073265660 10:102226956-102226978 CACACACAGCCACAAAGGACGGG - Intronic
1074385826 10:113015950-113015972 TAACCCCAGACCCCAAGGAATGG - Intronic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1074759117 10:116652770-116652792 CACCCACAGGCTCAAAGGAAAGG - Intergenic
1074762213 10:116675451-116675473 CACCAAAAGCCAGCAAGGAAGGG + Intronic
1075764930 10:124885624-124885646 CACCTACAGACCCCAGTGAAGGG - Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1080800065 11:35602115-35602137 CACCCTCACCTCCAAAGGAAAGG - Intergenic
1081419235 11:42853135-42853157 CACCAACATCCCCCAAATAATGG - Intergenic
1082091833 11:48096651-48096673 CAGCCACAAGCCCCCAGGAAGGG - Intronic
1082694189 11:56339363-56339385 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1082938486 11:58679095-58679117 CACCCACAGGCTCAAAGCAAAGG - Intronic
1083328308 11:61884970-61884992 CCTCCACAGCCCCCAAAGCAGGG + Intronic
1083457728 11:62790145-62790167 CCCCCCCACCCCCCAACGAAAGG - Exonic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085186716 11:74582006-74582028 CTCTCCCAGCCCCCAAGGGAAGG + Intronic
1085931035 11:81084093-81084115 CACCCACAGGCACAAAGTAAAGG - Intergenic
1085963984 11:81498439-81498461 CAGCCACAGGCCCCAGGGAGAGG + Intergenic
1086008337 11:82067570-82067592 CACCCACAGGCCCAAAGAAAAGG - Intergenic
1087437217 11:98136474-98136496 CACACACAGCCCTCCAGCAAAGG - Intergenic
1088903468 11:114136285-114136307 CACCCTCAGCCCCCAAACAGTGG - Intronic
1089178700 11:116566252-116566274 CCCCCACACCCCCAAAGTAAAGG - Intergenic
1089235438 11:117020540-117020562 CACCCTCAACCTCCAGGGAAAGG + Intronic
1089381774 11:118037997-118038019 CACCCTCAGCCCCACAGCAAGGG - Intergenic
1089819795 11:121213979-121214001 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1090181499 11:124704142-124704164 CTCACACAGGCACCAAGGAAAGG + Intergenic
1090189903 11:124760807-124760829 CCCCCACCCCCCACAAGGAAGGG + Intronic
1090847865 11:130545970-130545992 CACCCAAGGCCCCCAGGGATGGG + Intergenic
1091301533 11:134510933-134510955 CACACACACCCCCATAGGAAGGG - Intergenic
1091720604 12:2810654-2810676 CACCCCCTTCCCCCAAGAAAAGG + Intergenic
1092077309 12:5684465-5684487 CTCCCACTGCCCCCAGAGAAGGG - Intronic
1093490928 12:19703075-19703097 CACCCAGAGCCTCAAAGTAAAGG + Intronic
1097895688 12:64822957-64822979 CACCCACAGCACCCAGGTTATGG - Intronic
1098816514 12:75172051-75172073 CACCCTCACCCCCCAAAGAAAGG + Intronic
1099467269 12:83003287-83003309 CACCCACAGGCTCAAAGTAAAGG - Intronic
1101309856 12:103566905-103566927 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1101318223 12:103649346-103649368 CACCTCCAGCCCCCCAGGCAAGG + Intronic
1102313460 12:111865926-111865948 GACCCACAGCCCCAAAAGCATGG + Intronic
1102644522 12:114395579-114395601 CACCCACACCCCTCAAAGAAGGG + Intronic
1102782944 12:115581300-115581322 CCCCCAGAGCCTCCAAGAAAAGG + Intergenic
1103595292 12:122021640-122021662 CACCTGCAGCCTCCGAGGAAGGG + Exonic
1103800012 12:123532189-123532211 CACCCTGATCCCTCAAGGAAAGG + Intronic
1103844343 12:123891087-123891109 CACCCAGAGCTCAGAAGGAACGG - Intronic
1103951231 12:124552460-124552482 CAGCCACAGCCCCCAGGTCAAGG + Intronic
1104076078 12:125391357-125391379 CACCCACAGGCCCCAATCTAAGG - Intronic
1104948761 12:132429338-132429360 TTCCCACAGGCCCCATGGAAAGG - Intergenic
1105625655 13:22110353-22110375 GACACACAGCCTCCCAGGAAGGG - Intergenic
1106648413 13:31662457-31662479 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1107339197 13:39387947-39387969 CACTCACCGGCCCCCAGGAAAGG - Intronic
1110129048 13:71983770-71983792 CACCCATAGCCTCAAAGTAAAGG + Intergenic
1110866758 13:80405287-80405309 CACCCATAGGCTCAAAGGAATGG - Intergenic
1111064747 13:83075171-83075193 TACCCACAGGCTCAAAGGAAAGG + Intergenic
1111116286 13:83781960-83781982 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1111990863 13:95115838-95115860 CACCCCCAGACCCCATGAAAAGG + Intronic
1112337077 13:98524586-98524608 CACCCATTCACCCCAAGGAATGG + Intronic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1112758675 13:102669306-102669328 CCCTCACAACCCCCAAGGACAGG - Intronic
1112786546 13:102957670-102957692 CACCAGCAGCCAGCAAGGAATGG + Intergenic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113877084 13:113601357-113601379 CACCAACAGCCCACAAGGAGCGG - Intronic
1114382219 14:22219128-22219150 CACATACATACCCCAAGGAAAGG + Intergenic
1116536653 14:46040220-46040242 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1119748808 14:77063438-77063460 GACCCAGAGACCCAAAGGAAAGG + Intergenic
1121075046 14:91060688-91060710 CGCCCACAGCCAGCAAGGTAAGG + Intronic
1121302899 14:92886000-92886022 CACCCACGGCCACCAAGGTCAGG - Intergenic
1121519872 14:94578650-94578672 CACACACACCCCCCAAGAGAGGG - Intronic
1122721565 14:103725256-103725278 CACCCTCAGCACCAAAGGCACGG - Intronic
1123003985 14:105312631-105312653 GACCCACAGCCCTCAAGAGAAGG + Exonic
1123023228 14:105411868-105411890 CACCGTGGGCCCCCAAGGAAAGG - Exonic
1124019285 15:25904697-25904719 CAAACACAGCCCCCAAGAGATGG - Intergenic
1125148883 15:36507817-36507839 CACCCTCATCCCCAAAAGAATGG - Intergenic
1125685886 15:41563026-41563048 CCCCCACCCCTCCCAAGGAAAGG + Intronic
1127097245 15:55525212-55525234 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1127702922 15:61518744-61518766 CACCCACTGTCCCCCAGCAATGG + Intergenic
1128675716 15:69607091-69607113 CACCCACAGCCCCCAGAATAAGG - Intergenic
1129064260 15:72888303-72888325 CACCTCCAGCCTCCAGGGAAGGG - Intergenic
1129188339 15:73923791-73923813 CACCTCCAGCCACCAAGGCAAGG + Intergenic
1131022858 15:89114365-89114387 AACCCACAGACCCCAAGTTAAGG + Intronic
1131352891 15:91717778-91717800 CACCCAGAACCCTCAAGGCAAGG - Intergenic
1132316711 15:100895585-100895607 CACACACACCCCACATGGAAAGG + Intronic
1132581468 16:686597-686619 CACCCTCAGCTACCAAGGCAAGG + Intronic
1132964833 16:2647152-2647174 CACGCACCACCCCCAAGGGAAGG + Intergenic
1136171932 16:28495027-28495049 CAGCCAGGGCCCCCAGGGAAAGG + Intronic
1136381011 16:29895660-29895682 CACCCACAGCCCAGAGGAAAAGG + Intronic
1136391576 16:29968365-29968387 GTCACACAGCCCCCAAGGCAGGG - Intronic
1137592539 16:49702577-49702599 CACCCCCAGCCCTCAAGGAGAGG + Intronic
1137806539 16:51311605-51311627 GATCAACAGCCCACAAGGAATGG + Intergenic
1138229473 16:55326665-55326687 GACCCACACCTCCCGAGGAAAGG + Intronic
1138972830 16:62167437-62167459 CACCCACAGGCCCAAAATAAAGG - Intergenic
1139378862 16:66517694-66517716 CACCCACTGCCCCCAAGGGTTGG + Intronic
1140032298 16:71348474-71348496 CACCCACAGCAGCCGGGGAATGG + Intergenic
1142205421 16:88780507-88780529 GACCCACACCCAGCAAGGAAGGG + Intronic
1142672461 17:1493430-1493452 CACCGACAGCCCCATAGGCAGGG + Intergenic
1144137558 17:12312837-12312859 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1144761124 17:17708073-17708095 CACCCACCATCTCCAAGGAATGG + Intronic
1146768475 17:35546282-35546304 ACCCTAAAGCCCCCAAGGAAAGG + Intergenic
1148245019 17:46024854-46024876 CACCCCCGGCCACCAAGGACAGG - Exonic
1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG + Intergenic
1149153909 17:53603355-53603377 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1149443940 17:56699272-56699294 CACACACAGCCCCAAGGGACCGG + Intergenic
1150216670 17:63475355-63475377 CACCCACAGCCCTCAAAGCCTGG + Intergenic
1151139278 17:71976127-71976149 CACCCCCAGCCCCCAGGGCTTGG - Intergenic
1151538045 17:74749580-74749602 CACCCACAGACCCGAGGGAAGGG - Intronic
1151902660 17:77027181-77027203 AACCCACCGCCCCCAAGCCATGG + Intergenic
1151924671 17:77186262-77186284 GACCCACAGCCCCCAGGGGAGGG - Intronic
1152378014 17:79928659-79928681 CACCCTCACCTCCCAAGGCAAGG + Intergenic
1152598534 17:81249900-81249922 CAGCCACAGCCCCTCAGGCAGGG - Intronic
1153102943 18:1495102-1495124 CACCCACAGGCTCAAAGGAGAGG - Intergenic
1153424140 18:4944558-4944580 CCCTCACAGGCCCCCAGGAAAGG + Intergenic
1154411511 18:14144493-14144515 CTCCCACTGACCCCAAGGAGGGG + Intergenic
1155888907 18:31242206-31242228 CAGCAACAGCCCCCTGGGAATGG - Intergenic
1155910251 18:31497910-31497932 CACCCACAGTCCCCAACCCAAGG + Intergenic
1157935805 18:51871896-51871918 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1159387489 18:67744265-67744287 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1159796419 18:72849799-72849821 CTCCTGCAGCCTCCAAGGAAAGG - Intronic
1159940188 18:74400837-74400859 CACACACAGCACCCAAGAACAGG + Intergenic
1160080479 18:75722399-75722421 CAACCACAGCAATCAAGGAAAGG - Intergenic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1161687724 19:5711657-5711679 CACCCTGAGCCCCTTAGGAAGGG - Intronic
1161874539 19:6897702-6897724 CACCCACAGGCTCAAAGTAAAGG - Intronic
1161874673 19:6898838-6898860 CACCCACAGGCCCAAAGTAAAGG - Intronic
1163644819 19:18483194-18483216 CTGCCACAGCCCCCAGTGAAGGG + Intronic
1163685702 19:18710522-18710544 GACCCAAAGCCCCCATGGGAGGG - Intronic
1164598337 19:29545028-29545050 CACATACAGCCCCGAAGAAATGG + Intronic
1164618980 19:29682555-29682577 CACCCCCGGCCCCCACGAAACGG - Intergenic
1164861014 19:31562290-31562312 CACCCTCATCCGCCAAGCAAAGG + Intergenic
1165314676 19:35047349-35047371 CACACACAGACCACAAGGAAGGG - Intronic
1165581876 19:36872412-36872434 CACCCACTGCCCCCCAGGGAGGG - Intronic
1165723975 19:38099999-38100021 CGCCCACAGCCACCAAGCATGGG + Exonic
1165849443 19:38840670-38840692 GCCCCACAGCCCTCGAGGAAGGG - Intronic
1165914945 19:39252780-39252802 CATCCACAGGCCTAAAGGAAGGG + Intergenic
1166294552 19:41882813-41882835 CACCCACAGAGGCGAAGGAAGGG + Intergenic
1166338242 19:42121922-42121944 CACCCCCACCCCCTAGGGAAGGG + Intronic
1168071754 19:53957281-53957303 GAAACACAGCCCCCAAGGGAAGG - Intergenic
925054158 2:843229-843251 CATCCATAGTCCCCAGGGAAGGG + Intergenic
926288225 2:11507701-11507723 CACCCAGAGCCTCCAAGGGCAGG - Intergenic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
927325374 2:21799348-21799370 CACACATAGGCACCAAGGAAAGG + Intergenic
928034473 2:27808929-27808951 CACCCACTTCACCCCAGGAATGG + Intronic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
929625969 2:43407055-43407077 CATCCACTGCCTGCAAGGAAAGG - Intronic
929813053 2:45208080-45208102 CATCCACAGCCCTAAAGGAGCGG - Intergenic
930651199 2:53966643-53966665 CACCCGCAGCCCCTCATGAAAGG + Intronic
930895451 2:56440684-56440706 CACCCACTGCCTTGAAGGAAAGG - Intergenic
930897880 2:56466402-56466424 CACCCACAGGCTCAAAGTAAAGG + Intergenic
931501835 2:62877128-62877150 CACCCATAGGCCCAAAGTAAAGG + Intronic
932930047 2:76024810-76024832 CACCCACAGACTCAAAGTAAAGG - Intergenic
933118374 2:78502452-78502474 CACCCACAGGCACAAAGAAATGG + Intergenic
935148054 2:100409646-100409668 CACCCACAGCCACCTAGCTAGGG - Intronic
935918940 2:107988368-107988390 CACTCACAGATGCCAAGGAAGGG - Intronic
936052941 2:109239304-109239326 CTCCTATAGCCCCCTAGGAAGGG - Intronic
936801939 2:116280327-116280349 CACCCATAGGCTCCAAGTAAAGG + Intergenic
940851708 2:158693368-158693390 CACCCGCACACCCCAAGGCAGGG + Intergenic
941141308 2:161786289-161786311 CACCCACAGGCTCAAAGTAAAGG - Intronic
942122471 2:172792071-172792093 CAGCCACAGGCCCAAAGCAATGG - Intronic
942490827 2:176488220-176488242 CAACCACAGCCCCCATTTAATGG - Intergenic
943276883 2:185878584-185878606 CACCCACAGACTCAATGGAAAGG + Intergenic
943606329 2:189981372-189981394 CACCCACAGGCTCAAAGTAAAGG - Intronic
946698851 2:222389461-222389483 CACCCACACCCCCAAAGGTGTGG + Intergenic
947783457 2:232792250-232792272 CACCCAAAGCCCCCAAACTAGGG + Intronic
948900255 2:240953087-240953109 CACACACAGCCCCCAAGAGAGGG + Intronic
1169140159 20:3223251-3223273 AGCTCACAGACCCCAAGGAAAGG - Intronic
1172136343 20:32689352-32689374 CACCCAAGGCCCCCAGGGATGGG + Intergenic
1172214386 20:33224794-33224816 CATCCACTGCCCCCAAGAAAGGG + Intronic
1172479881 20:35264914-35264936 CACCCACAGCCCACAGGCTACGG + Intronic
1174094611 20:48078360-48078382 CAAACACAGACCCGAAGGAAAGG + Intergenic
1174114306 20:48216349-48216371 CACCCACAGCCCCAAAGCCCAGG - Intergenic
1174995627 20:55564998-55565020 CACCCACAGACTCAAAGTAAAGG - Intergenic
1175384828 20:58587489-58587511 CAGCCACAGCCCTCAGCGAATGG - Intergenic
1175443945 20:59007651-59007673 CGGCCACCGCCCCCAAAGAAGGG + Intergenic
1175954131 20:62599639-62599661 CCCCCACAGCCCCTAAAGAGTGG + Intergenic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1176861546 21:14013931-14013953 CTCCCACTGACCCCAAGGAGGGG - Intergenic
1177578354 21:22987697-22987719 CACCCACCCCCCCCAAAAAAAGG + Intergenic
1179024810 21:37671206-37671228 CACCCCCAACCTCCAGGGAAGGG + Intronic
1180082539 21:45493423-45493445 CACCCAGAGCCCCGAAGGCAGGG - Intronic
1181168360 22:20995043-20995065 CCCTCCCAGCCCCCAGGGAAGGG - Intronic
1181591026 22:23884676-23884698 CAGACACAGACACCAAGGAAAGG - Exonic
1183271999 22:36868111-36868133 CAGCCACAGCCATCCAGGAAAGG + Intronic
1183365051 22:37402581-37402603 TGCCCACAGTTCCCAAGGAAGGG + Intronic
1184257216 22:43294197-43294219 CACCCCCGGCCCCCGAGGAGGGG + Intronic
1184260930 22:43315681-43315703 CACACACAGCAGCCAAGAAAAGG - Intronic
1184540316 22:45118796-45118818 CACACACACGCCCCTAGGAATGG - Intergenic
1184748848 22:46472775-46472797 GACCCCCAGCCCCCAGGGAAAGG - Intronic
1184777811 22:46632086-46632108 CACAAACAGCCCACAACGAAAGG - Intronic
1185336929 22:50274907-50274929 GACCCACAGAGCCCAGGGAAGGG + Intergenic
1185366695 22:50440114-50440136 CTCCCACTGCCCCCAAGGAGGGG - Intronic
1185371118 22:50461419-50461441 CACCCAGAACCCCCGAGAAAAGG + Intronic
949946635 3:9194859-9194881 CACCCAAAGCAGCCAAGGGATGG - Intronic
950004771 3:9684655-9684677 TACTCACAGCCCACAAGGAAAGG - Exonic
950141822 3:10620953-10620975 CACCCTCAGCCCCCAATCCAGGG + Intronic
950675677 3:14552959-14552981 CTCCCACTGCCCCCAAGACAGGG + Intergenic
950992732 3:17458232-17458254 AACCCTCAGCCCCTGAGGAAGGG - Intronic
952699605 3:36312051-36312073 CACACACAGGTACCAAGGAAAGG + Intergenic
952990051 3:38823933-38823955 CACCCACAGCCCCCACCTCAGGG - Intergenic
954100447 3:48368259-48368281 CACCCACAGTCCCCGAGAGAAGG - Intergenic
954716940 3:52531652-52531674 CACCCACACCACCTATGGAAGGG - Intronic
955885583 3:63594979-63595001 AACACACAGACCCCAAGTAAGGG + Intronic
955892357 3:63663567-63663589 CACTCACCACCCCCAAGGCAGGG - Intronic
957918942 3:86723418-86723440 CACCCATAGACTCAAAGGAAAGG - Intergenic
960386778 3:117029986-117030008 CATCCCCAGCCCCCACTGAAAGG + Intronic
960763636 3:121099877-121099899 GACCCACAGGCTCAAAGGAAAGG + Intronic
961369137 3:126418977-126418999 CACCCACAGGCCCCAGGGCTGGG - Intronic
961772582 3:129260827-129260849 CACCCACGGCCCCCAGAGGAAGG + Intronic
963365013 3:144323592-144323614 AACCCACTGCCTCAAAGGAAAGG + Intergenic
963710899 3:148746543-148746565 CACACACTGCCCCCAAGGCCAGG + Intergenic
964133702 3:153319321-153319343 CACACACACACACCAAGGAAAGG + Intergenic
964652177 3:159024455-159024477 CACCCACAGGCTCCAAGTAAAGG - Intronic
965283261 3:166781989-166782011 CACCCACAGGCTCAAAGTAAAGG - Intergenic
967481765 3:189980917-189980939 CACCCACAGACCTCTGGGAAAGG + Intronic
967853600 3:194100173-194100195 CACCCACCGCCCACAAGGCACGG + Intergenic
968144284 3:196285542-196285564 CACTCACAGCCCTAAAGAAAGGG + Intronic
968232242 3:197010908-197010930 CACCCACATTCCCCAGGGGAAGG - Intronic
968569287 4:1331161-1331183 CACCCACACGCTCCAAGGAGGGG + Intronic
968591355 4:1461231-1461253 CACCCAGAGCCCCACAGCAAAGG - Intergenic
968674396 4:1870186-1870208 CACCTCCAGCCACCAAGGAGTGG - Intergenic
968887148 4:3341152-3341174 CGCCCACAGCCCCTAAAGACGGG - Intronic
968956890 4:3724093-3724115 CACCCACGGCCCCCGAGGGTGGG + Intergenic
968985435 4:3872080-3872102 CACCGAGAGCCCCCACGGCAGGG - Intergenic
969146158 4:5125848-5125870 CTCCCACAGACCCCCACGAAGGG + Intronic
969970079 4:11037857-11037879 CACCAACTGCCTCTAAGGAAAGG - Intergenic
972824305 4:42738707-42738729 CACCCAAAGGCCCAAAGTAAAGG + Intergenic
973196214 4:47445038-47445060 CACCCCCAGTTCCCAGGGAAAGG - Intergenic
973982325 4:56316552-56316574 CGCCCCCAGGCCCCGAGGAAAGG + Exonic
974077967 4:57184892-57184914 CAGCCACAGCGCCGAAGGAAGGG + Intergenic
974124028 4:57673738-57673760 CACACACAAACCCCAAAGAAGGG - Intergenic
976492795 4:85691706-85691728 CACCCACAGGCTCAAAGTAAAGG - Intronic
977715777 4:100181919-100181941 CACCTACAGGCCACAAAGAAGGG + Intergenic
978407673 4:108397062-108397084 CACCCTGAGCCCTCAGGGAAGGG - Intergenic
978478505 4:109160713-109160735 CACGCACTGACCCCAAGGGATGG + Intronic
979208706 4:118074609-118074631 CACCCATAGCCTCAAAGTAAGGG - Intronic
979917284 4:126452276-126452298 CACCCACCGCCCCCAAAAAAAGG + Intergenic
980023669 4:127738969-127738991 CACCCACAGGCTCAAAGTAAAGG - Intronic
981270650 4:142845248-142845270 AAACTACTGCCCCCAAGGAAGGG + Intronic
981453743 4:144929707-144929729 AACCCACAGCCACCACTGAATGG - Intergenic
981935064 4:150230406-150230428 CAAACACAGCCCCCAGGGAGAGG + Intronic
982143001 4:152346945-152346967 CACCTACAGGCCTCCAGGAATGG - Exonic
983747619 4:171221222-171221244 CACACACACCCCCCAAGCAACGG - Intergenic
983877159 4:172891052-172891074 CACCCATAGGCTCAAAGGAAAGG - Intronic
985787431 5:1904684-1904706 CCTCCACAGCCTCCAAGGCAGGG - Intergenic
986663927 5:10083499-10083521 CACCCACAGCACCAAATGGAAGG + Intergenic
986896027 5:12369709-12369731 CTCCCACAACCCCCAAACAAGGG - Intergenic
989216551 5:38909999-38910021 CACCCACAGGCTCAAAGTAAAGG + Intronic
989716150 5:44466163-44466185 CACCCACAGGCTCAAAGTAAAGG - Intergenic
990439224 5:55828028-55828050 CTCTCACAGCCCCCATGGAATGG + Intergenic
991217506 5:64172376-64172398 CCCCCACCCCCCACAAGGAATGG + Intronic
991530167 5:67605853-67605875 CACACATAGCAGCCAAGGAAGGG - Intergenic
992195021 5:74330553-74330575 CACCAACAGCCCCAAGGGAAGGG + Intergenic
993429835 5:87818437-87818459 CACCCACAGGCTCAAAGTAAAGG - Intergenic
995740452 5:115350456-115350478 CTGCCACAGCCACCAAGGAGAGG + Intergenic
997242284 5:132316116-132316138 CACCCTCTGGCCCTAAGGAAGGG + Intronic
997417683 5:133741531-133741553 CACCCATAGCAGCCAGGGAATGG + Intergenic
998137439 5:139681566-139681588 GACCCCCAGGCCCCAAGGACTGG - Intronic
999027985 5:148257672-148257694 CACCCACAGACTCCAAATAAAGG - Intergenic
999178879 5:149654604-149654626 CAACCACAGCCATTAAGGAAGGG + Intergenic
1000026686 5:157364592-157364614 GACCCCTAGCCCCCAAGGACTGG - Intronic
1003073097 6:2960027-2960049 CACCCACAGCCCATGAGGCAAGG - Exonic
1003232867 6:4270545-4270567 CACTCACAGCCCTCAAGGATGGG + Intergenic
1004229994 6:13823831-13823853 CACCCTCAGGCCCCAAGGAAAGG - Intergenic
1004667076 6:17758020-17758042 CCCCCAAAGGCCCCCAGGAAGGG + Intergenic
1006358188 6:33572975-33572997 CACCCAAGGCCCCCAGGGATGGG + Exonic
1007390052 6:41545847-41545869 CACCCCCAGCCCCCACGCAGTGG + Intergenic
1009461784 6:63922029-63922051 CACACACAGCCTTCGAGGAAAGG + Intronic
1013020788 6:106215351-106215373 TACCCTCACCCCTCAAGGAATGG + Intronic
1013727359 6:113115334-113115356 CACCCACAGACTCAAAGTAAAGG + Intergenic
1014489012 6:122038406-122038428 AAGATACAGCCCCCAAGGAAGGG - Intergenic
1015210417 6:130691427-130691449 CACCCATAGACCCAAAGTAAAGG + Intergenic
1017748873 6:157471436-157471458 CATCCAGAACCCCCGAGGAAAGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018094755 6:160375454-160375476 CACCCTCCACCCCCAAGCAATGG + Intronic
1018699999 6:166418870-166418892 CACCCACACACTCCTAGGAAAGG + Intronic
1018774072 6:166998431-166998453 CACCCACACTCTCCAAGGCAGGG + Intergenic
1018981901 6:168607693-168607715 CCCCCACCCCGCCCAAGGAAAGG - Intronic
1019211796 6:170412598-170412620 CAGCCACAGCTCACAAGGCAGGG - Intergenic
1019318825 7:405693-405715 CCCCCACACCCCCCATGGAGGGG + Intergenic
1023265928 7:38405474-38405496 CACCCACAGGCTCCAAGTAAAGG + Intronic
1023854526 7:44174181-44174203 CACACCCTGCCCCCAAGGAAGGG - Intronic
1024010073 7:45259655-45259677 CACAGGCAGTCCCCAAGGAAGGG - Intergenic
1025095394 7:56092129-56092151 CCTCCTCAGCCCCCCAGGAAAGG - Intronic
1027803491 7:82785169-82785191 CCCCCACAGCCCCCAATCCATGG - Intronic
1029421083 7:100472251-100472273 CACCCCCTGCCCCCTAGGAATGG - Intronic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1030836016 7:114286795-114286817 CACCAAAAGTACCCAAGGAAAGG + Intronic
1030985543 7:116237824-116237846 CACCCACACACACCAAGGAAAGG - Intronic
1031294626 7:119985461-119985483 CACCCATAGGCTCCAAGTAAAGG + Intergenic
1031641051 7:124163954-124163976 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1034112805 7:148554898-148554920 CACCCATAGGCTCCAAGTAAAGG - Intergenic
1034206066 7:149316623-149316645 CACCCACAGCCTTAAAGCAAAGG - Intergenic
1035861414 8:3032422-3032444 TGCCAACAGCCCCCACGGAATGG + Intronic
1036075102 8:5489911-5489933 CACCCACAGGCCCAAGGGAGAGG - Intergenic
1037839311 8:22232510-22232532 CACCAAAAGGCCCCAAGGAGAGG - Intergenic
1038421649 8:27437660-27437682 CTCCCACCGCCCCCAGGGAAGGG + Intronic
1039271564 8:35886788-35886810 CAATCTCAGCCCCCAAGCAAAGG - Intergenic
1039598189 8:38809682-38809704 GTCCCACAGCCCCCAAAGAAAGG - Intronic
1040944972 8:52874470-52874492 CACCCACACCCCACCAGCAAAGG - Intergenic
1041405987 8:57500208-57500230 TACACACAGCTCTCAAGGAAGGG + Intergenic
1041584739 8:59502356-59502378 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042963701 8:74329100-74329122 CCCACACAGCCCTCAAGAAAAGG - Intronic
1044137824 8:88609454-88609476 CCCACACAACCCCCAAGGACAGG - Intergenic
1046073250 8:109284065-109284087 CACCCACAGGCTCAAAGTAAAGG + Intronic
1046121801 8:109856547-109856569 CATCCACAACCTCCAGGGAAGGG - Intergenic
1046454735 8:114442888-114442910 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1046959909 8:120100335-120100357 CACCCACAGGCTCAAAGTAAAGG - Intronic
1047119883 8:121890169-121890191 CATCCACAGTCTCCAAGTAAGGG - Intergenic
1048350035 8:133608577-133608599 CAACCACACCCCTCAGGGAAGGG - Intergenic
1049018962 8:139940962-139940984 CACCCACAGCAGCCTATGAAGGG + Intronic
1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG + Intronic
1049390706 8:142368844-142368866 CACCCACAGTGGCTAAGGAAGGG + Intronic
1050132432 9:2426796-2426818 TACACACAGCCCCCAAGTACTGG + Intergenic
1051839896 9:21383785-21383807 CATCCACAGCCACAAAGGAATGG - Intergenic
1055001065 9:71448947-71448969 CACCCACATCCACCCATGAAGGG + Intergenic
1055107273 9:72526089-72526111 CGCCCCCAGCCCCCAAAGCAAGG - Intronic
1055207397 9:73749529-73749551 CACCCACAGGCTCAAAGTAAAGG - Intergenic
1057271775 9:93655697-93655719 CAACCCCAGCCTCCATGGAAGGG - Intronic
1057830264 9:98400858-98400880 CTCCTACCTCCCCCAAGGAAAGG - Intronic
1058246308 9:102630298-102630320 CACCCACAGACTCAAAGTAAAGG - Intergenic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1059428877 9:114238081-114238103 CACCCACAGCCACTCTGGAACGG + Intronic
1060399640 9:123340713-123340735 CCCCTCCAGCCCCCAAGGAAAGG - Intergenic
1060872848 9:127056592-127056614 CACCCCCAGCCCCAGTGGAATGG + Intronic
1061390730 9:130315807-130315829 CACCCATAGGTCCCAAGGAAAGG - Intronic
1061446332 9:130640306-130640328 GTCCCAGAGCCCCCAAGGTAGGG + Intergenic
1061816376 9:133199800-133199822 GACCCACAGGCCCCACGGAAAGG + Intergenic
1061825276 9:133254539-133254561 CACCTTCAGCCCCCACGGTAAGG - Intronic
1061968609 9:134030999-134031021 CACCCTCAGCCCGCCAGCAAGGG + Exonic
1185578625 X:1193333-1193355 CGGCCACAGCCCCGCAGGAAGGG + Intronic
1185620853 X:1451561-1451583 GACCCAGAACCCCCTAGGAATGG - Intronic
1186358316 X:8811085-8811107 GACCCACAGCTAACAAGGAATGG + Intergenic
1186548062 X:10472124-10472146 CACAAACACCACCCAAGGAATGG + Intronic
1186936152 X:14451746-14451768 CACCCACAGGCTCAAAGGAAAGG + Intergenic
1187115373 X:16344658-16344680 CAACCACAGGCCCAAAGTAAAGG - Intergenic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1189709556 X:43795520-43795542 CACCCCCAGCCTCCAGGGAGGGG - Intronic
1189725712 X:43966447-43966469 CACCCACTCCCTCCCAGGAAGGG + Intronic
1189926694 X:45961978-45962000 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1190635975 X:52434303-52434325 CACCCACAACCTTCAGGGAAGGG + Intergenic
1190803664 X:53814678-53814700 CCCCCACATACCCCTAGGAAGGG - Intergenic
1190955622 X:55190043-55190065 CACCCCCAACCCTCAGGGAAGGG - Intronic
1192866136 X:75134106-75134128 CACCCACAGGCTCAAAGTAAAGG + Intronic
1193210079 X:78797195-78797217 AACTCACAGCCCCAAAGGGAAGG - Intergenic
1193747129 X:85296104-85296126 CACCCACAGACTCAAAGTAAAGG - Intronic
1194923015 X:99791218-99791240 CACCCATGGCCTCAAAGGAAAGG - Intergenic
1195317884 X:103696352-103696374 CACCCCCCACCCCCAAAGAAGGG + Intergenic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1195931095 X:110077323-110077345 CACCCACAGGCTCAAAGTAATGG - Intronic
1196199418 X:112868750-112868772 CATCGACAGTCCCCAAGGAGAGG + Intergenic
1196215830 X:113050600-113050622 AACCCACTGCCCTGAAGGAAAGG + Intergenic
1196659172 X:118252174-118252196 CACACACACACACCAAGGAAGGG + Intergenic
1197141701 X:123124035-123124057 CACCCACAGGCTCAAAGTAAAGG + Intergenic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198221835 X:134609720-134609742 CACCCAGATGCACCAAGGAAAGG - Intronic
1199010599 X:142754059-142754081 CACCCACAGACCCCAAGTTCAGG - Intergenic
1199678382 X:150206818-150206840 CACCCTGAGACCCCATGGAAAGG - Intergenic
1200875093 Y:8146223-8146245 CCGCCTCAGCCCCCAAGGATTGG - Intergenic