ID: 907409333

View in Genome Browser
Species Human (GRCh38)
Location 1:54273684-54273706
Sequence TTGCTCCTCTGTCCAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 261}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907409333_907409340 3 Left 907409333 1:54273684-54273706 CCCCCCACTGGACAGAGGAGCAA 0: 1
1: 0
2: 2
3: 29
4: 261
Right 907409340 1:54273710-54273732 AAGGCCAAGAGAGAGAAGGCTGG No data
907409333_907409342 13 Left 907409333 1:54273684-54273706 CCCCCCACTGGACAGAGGAGCAA 0: 1
1: 0
2: 2
3: 29
4: 261
Right 907409342 1:54273720-54273742 GAGAGAAGGCTGGCTCCCCGAGG No data
907409333_907409343 22 Left 907409333 1:54273684-54273706 CCCCCCACTGGACAGAGGAGCAA 0: 1
1: 0
2: 2
3: 29
4: 261
Right 907409343 1:54273729-54273751 CTGGCTCCCCGAGGACACACAGG No data
907409333_907409339 -1 Left 907409333 1:54273684-54273706 CCCCCCACTGGACAGAGGAGCAA 0: 1
1: 0
2: 2
3: 29
4: 261
Right 907409339 1:54273706-54273728 AGCTAAGGCCAAGAGAGAGAAGG No data
907409333_907409346 29 Left 907409333 1:54273684-54273706 CCCCCCACTGGACAGAGGAGCAA 0: 1
1: 0
2: 2
3: 29
4: 261
Right 907409346 1:54273736-54273758 CCCGAGGACACACAGGAATTTGG 0: 1
1: 0
2: 4
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907409333 Original CRISPR TTGCTCCTCTGTCCAGTGGG GGG (reversed) Intronic