ID: 907409626

View in Genome Browser
Species Human (GRCh38)
Location 1:54274964-54274986
Sequence CAGCCCAAATGTCACCCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907409618_907409626 13 Left 907409618 1:54274928-54274950 CCCACCTCAATTCACTGCCAATT 0: 1
1: 0
2: 1
3: 11
4: 225
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data
907409620_907409626 9 Left 907409620 1:54274932-54274954 CCTCAATTCACTGCCAATTGCCT 0: 1
1: 0
2: 0
3: 21
4: 241
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data
907409615_907409626 26 Left 907409615 1:54274915-54274937 CCTGGCACACTCCCCCACCTCAA No data
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data
907409621_907409626 -4 Left 907409621 1:54274945-54274967 CCAATTGCCTCCTCCTCCTCAGC No data
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data
907409616_907409626 15 Left 907409616 1:54274926-54274948 CCCCCACCTCAATTCACTGCCAA 0: 1
1: 0
2: 1
3: 20
4: 237
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data
907409617_907409626 14 Left 907409617 1:54274927-54274949 CCCCACCTCAATTCACTGCCAAT No data
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data
907409619_907409626 12 Left 907409619 1:54274929-54274951 CCACCTCAATTCACTGCCAATTG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 907409626 1:54274964-54274986 CAGCCCAAATGTCACCCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907409626 Original CRISPR CAGCCCAAATGTCACCCCCT CGG Intronic
No off target data available for this crispr