ID: 907419501

View in Genome Browser
Species Human (GRCh38)
Location 1:54337330-54337352
Sequence GGGTGGGTTATTGCAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907419501_907419508 1 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419508 1:54337354-54337376 GGCCTGCCCTCTCAAGGAAGAGG 0: 1
1: 0
2: 0
3: 23
4: 149
907419501_907419516 21 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419516 1:54337374-54337396 AGGCGCAGGGATCTTAGGGCAGG No data
907419501_907419505 -5 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419505 1:54337348-54337370 CACCCTGGCCTGCCCTCTCAAGG 0: 1
1: 0
2: 3
3: 43
4: 392
907419501_907419515 17 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419515 1:54337370-54337392 GAAGAGGCGCAGGGATCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 118
907419501_907419511 7 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419511 1:54337360-54337382 CCCTCTCAAGGAAGAGGCGCAGG 0: 1
1: 0
2: 2
3: 8
4: 148
907419501_907419513 8 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419513 1:54337361-54337383 CCTCTCAAGGAAGAGGCGCAGGG 0: 1
1: 0
2: 1
3: 13
4: 149
907419501_907419514 16 Left 907419501 1:54337330-54337352 CCTTGCTTTGCAATAACCCACCC 0: 1
1: 0
2: 2
3: 9
4: 167
Right 907419514 1:54337369-54337391 GGAAGAGGCGCAGGGATCTTAGG 0: 1
1: 0
2: 3
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907419501 Original CRISPR GGGTGGGTTATTGCAAAGCA AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
903659504 1:24968452-24968474 GGGTGGGACATTGTAAAGGATGG - Intergenic
904186304 1:28707799-28707821 GTGTGTGTTATTTCAAACCATGG + Intronic
904387572 1:30154070-30154092 GGGTGGGACAATTCAAAGCAGGG + Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906802606 1:48750780-48750802 GGCTGGGTGATTGCATGGCAGGG + Intronic
907419501 1:54337330-54337352 GGGTGGGTTATTGCAAAGCAAGG - Intronic
911210303 1:95131973-95131995 GAGTGGGTTATTATAAAGCTGGG + Intronic
915712048 1:157909454-157909476 GAGTGGGTTGTTGTAAAGCAGGG + Intergenic
916841572 1:168606965-168606987 GAGTGGGTTTTTACAAAGCTAGG + Intergenic
920212737 1:204340210-204340232 GGGTGTGTTATTCCCCAGCAGGG + Intronic
921557290 1:216614045-216614067 TGGTGTGTTTTTGTAAAGCAGGG - Intronic
922050950 1:221990266-221990288 GGGAGGATTAAAGCAAAGCAGGG - Intergenic
922566889 1:226606863-226606885 TGATGAGTTAATGCAAAGCAGGG - Exonic
924622551 1:245674734-245674756 GGCTGAGTTACTGCAAAGAAAGG + Intronic
924680841 1:246231098-246231120 GTGTGGGTTATTGCTAAGCATGG + Intronic
1063888112 10:10600224-10600246 GCGTGGGCGTTTGCAAAGCAAGG + Intergenic
1063985136 10:11494017-11494039 GGGTGTGTTCCTGCAGAGCAAGG - Intronic
1066446042 10:35484629-35484651 GGGTGGGATAATACAAAGGAAGG + Intronic
1071069205 10:81671604-81671626 GGGTTGATGAATGCAAAGCATGG + Intergenic
1071573913 10:86712194-86712216 GGGTGGGTTAGCCCCAAGCAAGG + Intronic
1072994167 10:100228824-100228846 GGGTGAGTTGGTGCAGAGCATGG - Intronic
1075605072 10:123799050-123799072 GGGTGGGGTTTTGCAAAGAGAGG - Intronic
1076805606 10:132857118-132857140 GGGTGGGTTCTTCCCCAGCATGG + Intronic
1078655716 11:13237038-13237060 AAGTGGGCTATTGAAAAGCAAGG - Intergenic
1080438412 11:32268039-32268061 GGGTGGGGGAGTGGAAAGCAGGG - Intergenic
1082000017 11:47389155-47389177 GGGTGAGTTAGTGCCCAGCACGG - Intergenic
1083728177 11:64639314-64639336 GGATGGTTTATGGCCAAGCAGGG - Intronic
1084432127 11:69116943-69116965 GGGTGAGTTATTGCCAGGCCTGG + Intergenic
1085330903 11:75650116-75650138 GGGTGCGTGATGTCAAAGCATGG - Intronic
1086406828 11:86505771-86505793 GGCTGTCTTATTGCAAAGCTGGG + Intronic
1087923693 11:103895545-103895567 TGGTGGTTTGTTGCACAGCACGG - Intergenic
1087953091 11:104249440-104249462 TGGTGATATATTGCAAAGCACGG + Intergenic
1089198923 11:116711610-116711632 GCGTGGGGCATTGGAAAGCAGGG - Intergenic
1092230566 12:6773486-6773508 GGGTCGCTGATTGCAGAGCAAGG - Intronic
1096732441 12:53625644-53625666 GGGTGGATTATTGGAAATGAGGG - Intronic
1097274462 12:57803004-57803026 GGCTGGATTTTTCCAAAGCAAGG + Intronic
1098825022 12:75285523-75285545 GGGTGATCTATTGCACAGCATGG - Intronic
1105072327 12:133242237-133242259 GCGTGGTTTGTTGCAAAGCTAGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106552135 13:30781124-30781146 GGGTGGGTTGTTACAAAGTGAGG + Intergenic
1107428014 13:40313593-40313615 GATTGGGTTATTCCAATGCATGG + Intergenic
1111364316 13:87221851-87221873 TGGTGATTTATTGCACAGCATGG + Intergenic
1112301300 13:98233065-98233087 GGGTAGGTTTTTCCAAGGCATGG + Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113801500 13:113088846-113088868 GGGTGGGCTGTTCCACAGCACGG + Intronic
1114067042 14:19069565-19069587 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
1114095223 14:19330463-19330485 GGGTGGGTCATTTCAAAGTGAGG - Intergenic
1116302063 14:43195480-43195502 GGCTGGGTTATTATAAAGAAAGG - Intergenic
1117903485 14:60560286-60560308 GGGTGGGTAATTCTAGAGCATGG + Intergenic
1118313968 14:64714196-64714218 GGATGGGATACTTCAAAGCAAGG + Intronic
1120695501 14:87639985-87640007 TGCTGGGTTATTTCAAAGGAGGG - Intergenic
1121650133 14:95552124-95552146 GGGTGGGATATTGTGAAGGAGGG + Intergenic
1124193837 15:27603202-27603224 GAGTGGGTTGTTACAAAGCCAGG + Intergenic
1125766675 15:42141092-42141114 AGGTGGGTTACTCCAAGGCATGG - Exonic
1126065210 15:44821281-44821303 GAGTGGGTTGTTACAAAGCCAGG + Intergenic
1126094620 15:45079302-45079324 GAGTGGGTTGTTACAAAGCCAGG - Intergenic
1126998023 15:54467545-54467567 TGGTGTTTTATTGCATAGCATGG - Intronic
1128635955 15:69302577-69302599 GGGTGGATTTCTTCAAAGCAAGG - Intronic
1128879716 15:71231990-71232012 GGGTGGGTTTTAGGAAAACAGGG + Intronic
1136036245 16:27542728-27542750 GAGTGGGTTGATGTAAAGCAAGG + Intronic
1138604308 16:58078053-58078075 TGGTGAGTTATGGAAAAGCAAGG + Intergenic
1141377927 16:83548788-83548810 GGGTGGAATATTGGAAGGCAGGG - Intronic
1141822053 16:86453186-86453208 GGGTGGTTTGTTACAAAGCACGG + Intergenic
1141885957 16:86892518-86892540 AGGTAGGTTGTAGCAAAGCATGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1145934200 17:28705500-28705522 GGGTGGGTCATTCGAAAGCCTGG - Intronic
1149447661 17:56726107-56726129 GGCTGAGTTCTTGCAGAGCAAGG - Intergenic
1150587409 17:66531427-66531449 GGGGGAGTTCTGGCAAAGCAAGG - Intronic
1156092950 18:33493584-33493606 GAGTGGGTTGTTATAAAGCAAGG + Intergenic
1160309617 18:77777394-77777416 GGGTGAGTTATTTGAAAGTAGGG - Intergenic
1160795002 19:941130-941152 GCGTGTGTTATTAGAAAGCATGG - Intronic
1161777502 19:6271649-6271671 GGGGAGGTTTTTACAAAGCAGGG - Intronic
1162194478 19:8973766-8973788 GGGTGGGTGATTGTAAAGGGTGG + Exonic
1162644979 19:12042248-12042270 GGGTGGGATATTTTAAAGCTGGG - Intronic
1164586807 19:29480826-29480848 GGGTGGGTGAGTGGACAGCAAGG - Intergenic
1166250709 19:41569146-41569168 TGGTGGACTATTGCATAGCATGG + Intronic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
939266871 2:139885427-139885449 GTGTGGGTTATTATAAAGCCAGG - Intergenic
942397031 2:175561104-175561126 GGGTGGGTGGTTGCAAAGAGAGG - Intergenic
945454323 2:210032641-210032663 GGGCGGGACATTTCAAAGCAGGG - Intronic
945518817 2:210797540-210797562 GGCTGGTTTATTCCATAGCAGGG + Intergenic
945637178 2:212370075-212370097 GGGGGGATTATTGCAATTCAAGG - Intronic
946665541 2:222046086-222046108 GACTGGGTTATTATAAAGCAAGG + Intergenic
946966000 2:225038870-225038892 AGGTGGGTTAGTGCAATGGAAGG - Intronic
947280570 2:228448477-228448499 GGGTGGGCTATGGGAAAGGAGGG - Intergenic
948547393 2:238742611-238742633 GGGTGGCTTATTACAAAGGGTGG - Intergenic
1169942708 20:10954459-10954481 TTGAGGGTCATTGCAAAGCAAGG + Intergenic
1170949171 20:20920520-20920542 GGGTGGGATATTGAAAAAAAAGG - Intergenic
1173403820 20:42747769-42747791 GGGTGGGGCATTACAAATCAAGG + Intronic
1176204212 20:63879305-63879327 GTGTGGTTTATGGCACAGCAGGG + Intronic
1178621341 21:34179383-34179405 AGGTGGGTGGTTGCTAAGCAGGG + Intergenic
1178773737 21:35529193-35529215 GGGTTTGTTATTGCACAGCTTGG + Intronic
1180485519 22:15792149-15792171 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
949403619 3:3691735-3691757 GGTTGTGTTATTGCAATGCTAGG + Intergenic
951176711 3:19609912-19609934 GGGGGGGTTATTACAATTCAAGG + Intergenic
952454999 3:33464590-33464612 GGGTGGGACAATTCAAAGCAGGG - Intergenic
953925501 3:46980479-46980501 GGGTGGGTCATTTCAAGTCAGGG - Intronic
955964724 3:64377192-64377214 TGGTGGTCTATTGCACAGCATGG + Intronic
958950659 3:100412208-100412230 AAGTGGGTTATTACAAAGCAAGG - Intronic
959903883 3:111689500-111689522 AGGTGGGTTATTGGAAGGGAGGG - Intronic
962804875 3:138919824-138919846 AGGTGGGACAATGCAAAGCATGG - Intergenic
966130396 3:176631300-176631322 GGGTTGGTTATTGCAAAACTTGG + Intergenic
970995856 4:22267045-22267067 GGGTGGGTTATTATAAAGTGAGG + Intergenic
971699301 4:29948645-29948667 GGGTGAGGATTTGCAAAGCAGGG - Intergenic
974130651 4:57751420-57751442 GGGTGAGTTATTGAAACTCAAGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
975373206 4:73612129-73612151 GGGTGAGTTATTGCAATAGAAGG - Intronic
975975239 4:80088051-80088073 GAGTGGGTTTTTGTAAAGCCAGG - Intronic
982973239 4:162017957-162017979 GGAGGGGTTCTAGCAAAGCAAGG - Intronic
982999310 4:162392200-162392222 GGGGAGTTTTTTGCAAAGCATGG - Intergenic
985837219 5:2280336-2280358 GGGTGGGTTATTGAATAGATGGG + Intergenic
986380498 5:7180751-7180773 GGATGCGTTATTACAAAGAAAGG - Intergenic
989235658 5:39145844-39145866 GGGAGGATTATTCCAAAGAAGGG - Intronic
990061421 5:51653987-51654009 AGGTTGTTTATTGCAAACCAAGG + Intergenic
990861851 5:60336026-60336048 GGGTAGGTTATTGGAGAGCGAGG + Intronic
991243775 5:64488084-64488106 GAGTGGGTTGTTACAAAGCCAGG - Intergenic
993384095 5:87243370-87243392 TGGTGAGTCATAGCAAAGCATGG + Intergenic
994221118 5:97196409-97196431 TGGTGGTCCATTGCAAAGCAAGG - Intergenic
996465367 5:123795988-123796010 GAGTGGGTTGTTGCAAAACCAGG - Intergenic
997394271 5:133545386-133545408 GAGTGTGTTATTATAAAGCAAGG + Intronic
997847085 5:137296454-137296476 GGATGGGTGACTGCAAAGCATGG + Intronic
998469058 5:142369191-142369213 GGGTGCTTTATTCCAAAGAAGGG - Intergenic
998700187 5:144689453-144689475 AGGTGGGACATTTCAAAGCAGGG - Intergenic
999606713 5:153324520-153324542 GATGGGGTTATTGCCAAGCAGGG - Intergenic
1000165005 5:158639894-158639916 GTGTGTGTTTTTACAAAGCATGG - Intergenic
1001101363 5:168817254-168817276 GGGTGGGTCATAGCACAGGAGGG + Intronic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1002758904 6:186675-186697 GGCTGTGGTGTTGCAAAGCAGGG + Intergenic
1007286814 6:40753791-40753813 GAGTGGGTTATTAAAAAGCATGG - Intergenic
1008436256 6:51479936-51479958 TGGTGGGTTATAGCTCAGCATGG - Intergenic
1009789039 6:68376710-68376732 TGGTGGTTTATTGCAGAGTATGG - Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010914689 6:81601391-81601413 TGGTGATTTATTGCAAAGTATGG - Intronic
1011486577 6:87848456-87848478 GGCTGGCTCATTGCAGAGCAAGG + Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1012023402 6:93956101-93956123 GGGTGGGTAAGTTCAAAGGAAGG - Intergenic
1013583152 6:111555612-111555634 GGGTGGGTTTGTGGAATGCAAGG - Intergenic
1015080140 6:129214299-129214321 GGGTGGGTTGTTAAAAAGGAAGG - Intronic
1015416443 6:132954352-132954374 GGCTGGGGTATTACAGAGCAGGG - Intergenic
1015771921 6:136777201-136777223 GTGTATATTATTGCAAAGCAGGG - Intronic
1017814254 6:158005483-158005505 GGGAGGGTGAGTGCAAGGCAGGG - Intronic
1019331082 7:461143-461165 GGGTGGGTGGTTCCAAGGCATGG + Intergenic
1023959133 7:44912257-44912279 CGGTGGGTTCTTGCCAAGAAGGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026430770 7:70344972-70344994 AGGTGGCTGTTTGCAAAGCAGGG + Intronic
1026594427 7:71722501-71722523 GGGTAGGACATTGGAAAGCATGG + Intergenic
1026612925 7:71876322-71876344 GAGTGGGTTGTTATAAAGCAAGG + Intronic
1027992473 7:85380122-85380144 GAGTAGGTTATTGAAAATCATGG - Intergenic
1029157894 7:98530211-98530233 GGGTGGGTTATCTTGAAGCAGGG + Intergenic
1029339527 7:99931820-99931842 GAGTGGGTTGTTGTAAAGCCAGG - Intergenic
1030050582 7:105533450-105533472 TGGCAGGTTATTGCAAATCAAGG + Intronic
1032461676 7:132116133-132116155 GCATGGGTTATTGGAAATCAGGG + Intergenic
1035492921 7:159295676-159295698 GCGTGGTTTGTTGCAAAGCTAGG - Intergenic
1036938800 8:13031726-13031748 GGGTGGGGTGTTGGGAAGCAAGG - Intergenic
1036999898 8:13705644-13705666 GGGTGGGGTAGAGGAAAGCAAGG - Intergenic
1041315671 8:56559752-56559774 TGGTGGTTTATTGCAAAACATGG - Intergenic
1042061457 8:64822718-64822740 GCGTGGCATATTCCAAAGCAGGG + Intergenic
1042113511 8:65407022-65407044 GTGTGGGTTGTTGTAAAGCTAGG - Intergenic
1044703009 8:94981214-94981236 GAGTGGGTTGTTATAAAGCAAGG + Intronic
1046152216 8:110242675-110242697 GATTGGATTATTGCATAGCAGGG + Intergenic
1046607394 8:116387021-116387043 GACTGGGTTATTGTAAAGAAAGG - Intergenic
1048390698 8:133961170-133961192 GGATGGGTTATTTCAGAGCGTGG + Intergenic
1052253058 9:26422796-26422818 GGGTGGGGTGTTGAAATGCAAGG + Intergenic
1060747085 9:126144758-126144780 GGGTGTATTATTGGAAGGCAAGG + Intergenic
1061836810 9:133334882-133334904 TGGTAGCTTATTGTAAAGCAGGG - Intronic
1186322030 X:8438076-8438098 TGATGGGATATTGCAAAGCATGG + Intergenic
1186522747 X:10220597-10220619 GGGTGGGGAATTGCTCAGCAAGG + Intronic
1187356710 X:18580587-18580609 GGGTGGTTTATAGCAATGAAAGG + Intronic
1188139987 X:26537926-26537948 GGGTGGGTGAGTGCAGAGTATGG + Intergenic
1189924049 X:45934270-45934292 GAGTGGGTTGTTACAAAGCCAGG + Intergenic
1191997855 X:67115644-67115666 GGGGGGGTTAGGGTAAAGCAGGG + Intergenic
1192450554 X:71242095-71242117 TGGTGGGTTATGGCAGGGCATGG + Intronic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1195580587 X:106496685-106496707 GAGTGGGTTGTTGTAAAGCCAGG + Intergenic
1197469204 X:126847418-126847440 GAGTGGGTTATTACAAAGCCTGG - Intergenic
1199848471 X:151708500-151708522 GGGTGGGTGCTGGCAGAGCATGG + Intergenic