ID: 907419989

View in Genome Browser
Species Human (GRCh38)
Location 1:54340789-54340811
Sequence GCAGCCCTCTGGGCTGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907419989_907419998 16 Left 907419989 1:54340789-54340811 CCCATACCAGCCCAGAGGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 907419998 1:54340828-54340850 GTACAGCCCCACTGGCTAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 95
907419989_907419995 -6 Left 907419989 1:54340789-54340811 CCCATACCAGCCCAGAGGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 907419995 1:54340806-54340828 GGCTGCAGGCTCCTACAAGTAGG No data
907419989_907419999 19 Left 907419989 1:54340789-54340811 CCCATACCAGCCCAGAGGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 907419999 1:54340831-54340853 CAGCCCCACTGGCTAAGAGGAGG 0: 1
1: 0
2: 0
3: 15
4: 156
907419989_907420003 26 Left 907419989 1:54340789-54340811 CCCATACCAGCCCAGAGGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 907420003 1:54340838-54340860 ACTGGCTAAGAGGAGGCAGAAGG 0: 1
1: 0
2: 0
3: 33
4: 353
907419989_907419997 8 Left 907419989 1:54340789-54340811 CCCATACCAGCCCAGAGGGCTGC 0: 1
1: 0
2: 1
3: 16
4: 216
Right 907419997 1:54340820-54340842 ACAAGTAGGTACAGCCCCACTGG 0: 1
1: 0
2: 0
3: 6
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907419989 Original CRISPR GCAGCCCTCTGGGCTGGTAT GGG (reversed) Intronic
900830644 1:4963005-4963027 GCAGATCTCCGGGCTGGGATGGG - Intergenic
901866375 1:12109620-12109642 GCAGTTCTCTGGGCTGGCACAGG - Exonic
902569609 1:17338745-17338767 GCAAACCTCTGGGCTGCTAAGGG + Intronic
902770282 1:18641821-18641843 GCAGCCATCTGCGCTGCTCTCGG + Intronic
904288600 1:29469632-29469654 TCAGCCCTCTGAGGTTGTATGGG - Intergenic
904375824 1:30081862-30081884 GCAGACCTCTGGGCTGCTACTGG + Intergenic
905022564 1:34827970-34827992 GCTGCACTCTGAGCTGGCATTGG + Intronic
905858512 1:41330690-41330712 GCAGCCCTCTGTTCTGGGAGGGG - Intergenic
906075868 1:43051732-43051754 GCAGGCCTCTGGGCAGAAATGGG + Intergenic
907419989 1:54340789-54340811 GCAGCCCTCTGGGCTGGTATGGG - Intronic
910598382 1:89004684-89004706 GCCCAGCTCTGGGCTGGTATTGG + Intergenic
912415821 1:109507773-109507795 ACAGCCCACTAGGGTGGTATAGG + Exonic
912495029 1:110086011-110086033 GCAGCCTTCTGGGCTGGGGCAGG + Intergenic
912718934 1:112003515-112003537 GCAGTCCTCTGGGTTCTTATTGG + Intergenic
916694135 1:167220243-167220265 CCGGCCCTCTGGGCAGGTAGGGG - Intergenic
919520478 1:198582046-198582068 GCTGGGCTCTGGGCTGGTACTGG + Intergenic
920380578 1:205532440-205532462 GCCGCCCTCTGGGGTGGCAGGGG - Intronic
922796885 1:228344619-228344641 GCAGCTCTCAGGGGTGGTGTGGG + Intronic
923068562 1:230542239-230542261 GCTGCACTGGGGGCTGGTATTGG - Intergenic
924648468 1:245902120-245902142 GCAGCCCTCTGAGTGGATATGGG - Intronic
924768023 1:247052387-247052409 GCTGGACTCTGGGCTGGTACTGG + Intronic
1064557147 10:16559023-16559045 ACAGGGCTCTGGGCTGGTACTGG + Intergenic
1067702009 10:48580518-48580540 GCAGTGCTGTGGGCTGGTACAGG + Intronic
1068263364 10:54614222-54614244 TCAGCCCTCTAGGCTAGTGTTGG - Intronic
1068302412 10:55161408-55161430 TCAGCCCACTGGGCTGGATTTGG - Intronic
1068859733 10:61835175-61835197 CCAGCCCTCTGGCCTTGTCTAGG + Intergenic
1069269941 10:66513934-66513956 GCAACCTTCTGGGATGGTGTCGG + Intronic
1069907826 10:71742186-71742208 GCAGCTCTATGGGGTGGTACAGG + Intronic
1070512340 10:77172960-77172982 GGAGCCCTCAGGAATGGTATTGG - Intronic
1071523957 10:86347469-86347491 TCAGCTCACTGGGCTGGTATGGG - Intronic
1071568061 10:86681623-86681645 GGCCCCCTCTGGGCTGGTCTTGG - Exonic
1074190353 10:111130049-111130071 ACAGCCCTCTGGACTGGCCTTGG - Intergenic
1077300885 11:1846411-1846433 GCAGCCCACTGGGGTGGAGTGGG - Intergenic
1077432945 11:2525098-2525120 GCAGCCCCCAGGGCTGGGCTGGG - Intronic
1078829815 11:14968700-14968722 GTGGCTCTTTGGGCTGGTATTGG - Exonic
1081983604 11:47285546-47285568 GAAGCCCTCGGTGCTGGTGTTGG - Exonic
1084531161 11:69728698-69728720 TCAGCCCTCTGGCTTGGCATGGG - Intergenic
1085081383 11:73637200-73637222 GCAGCCATTTTGGCTGGAATTGG - Intergenic
1085701270 11:78747988-78748010 TCAGCCCTCTGTGCTGGAAGAGG - Intronic
1085994446 11:81893736-81893758 GCAGCCCTCTGGGTTGATATGGG + Intergenic
1087151058 11:94860191-94860213 CCTGCCCTCAGGGCTGCTATGGG - Intronic
1088797370 11:113274828-113274850 GCAGCCTGCTGGGCTGGGCTGGG - Intronic
1089586831 11:119514983-119515005 GCTGCATCCTGGGCTGGTATTGG + Intergenic
1090276389 11:125422676-125422698 GCAGCCCTCTGGGGTGTCCTGGG - Intronic
1091678708 12:2510759-2510781 GCACCCCTCTGGGGTGGGTTTGG - Intronic
1097247090 12:57612625-57612647 GCAGCCATCTGGGCAGACATTGG - Intronic
1102167576 12:110818970-110818992 GCAGCCCTGAGGGCTGTTAGTGG + Intergenic
1104044423 12:125151774-125151796 GCAGGCCACTGGACTGGTACTGG - Intergenic
1104672003 12:130686863-130686885 GCTGCCTTCTGGGCTCGTAGCGG - Intronic
1105408718 13:20151943-20151965 GCATGCCCCTGGGCTGGTGTCGG + Intronic
1108464768 13:50704466-50704488 GCAGCCCTCTAAGCTGCCATGGG - Intronic
1108578609 13:51810215-51810237 GCAGAGCTCTGCGCTGGTAATGG + Intergenic
1110317666 13:74129993-74130015 GCAGCTCTCTGGGCTGGGCTTGG + Intronic
1112228865 13:97568068-97568090 GCTTCCCTGTGGGCTGGTCTGGG - Intergenic
1113421088 13:110171969-110171991 GAAACACTCTGGGCTGGTCTCGG + Intronic
1115707524 14:36014099-36014121 GCACCCCTCTTGCCTGGGATTGG - Intergenic
1118601314 14:67472950-67472972 GCAGGCCCCTGGGGAGGTATTGG + Exonic
1119582624 14:75800766-75800788 GCTGGGCTCTGGGCTGGTACTGG + Intronic
1121388407 14:93551966-93551988 GAATCCTTCTGGGATGGTATGGG + Intronic
1124264201 15:28219257-28219279 GCAGCCCGCTTGGCTGGCTTTGG + Intronic
1124365103 15:29065597-29065619 GGAGCCCTCTGGGCTGATAGAGG + Intronic
1131061000 15:89404712-89404734 GCAGCCTTGTGGGATAGTATGGG - Intergenic
1138678812 16:58670655-58670677 ACTGCCCTCTGGGCTGTAATGGG + Intronic
1139318328 16:66092349-66092371 GGAGCCCTCTGGGAGTGTATGGG - Intergenic
1139396160 16:66640829-66640851 GCAGCCCTATGGAGAGGTATAGG + Intronic
1141744754 16:85918474-85918496 GCAGCCCTCGGGGCAGGTGGTGG - Exonic
1142137226 16:88456957-88456979 GCAGCTGCCTGGGCTGGAATAGG - Intronic
1142478086 17:201536-201558 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142478105 17:201619-201641 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142478124 17:201702-201724 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142478143 17:201785-201807 GCAGACGTCTGGGGTGGGATGGG + Intergenic
1142692188 17:1613326-1613348 GCAGGACTCTGGGCTGGTCCCGG - Intronic
1143102616 17:4512813-4512835 GGAGCCCTCTGGCCTGGGAGGGG - Intronic
1143343649 17:6233755-6233777 GCAGCTCTCTGGGCGGGTTGTGG + Intergenic
1143453928 17:7053651-7053673 GCAGCCCTAAGGGCTGATGTGGG - Intergenic
1143579651 17:7818111-7818133 GCATCCCACTTGGCTGGTCTTGG - Intronic
1145724808 17:27109232-27109254 TCAGCCCACTGGGCTGGATTTGG + Intergenic
1146057680 17:29589398-29589420 GCAGCCCTCTGGGCCAGCGTGGG + Exonic
1146059069 17:29595006-29595028 GCAGGCCTCTGGGCCGGTCTGGG + Intronic
1147683887 17:42275909-42275931 GCAGCCCCCTGAGCTCCTATGGG + Intronic
1147904542 17:43814218-43814240 GCCGCTCTCCGGGCTGGTGTTGG + Exonic
1149538711 17:57452459-57452481 ACAGGCCTCTGGCCTGGCATGGG - Intronic
1149665242 17:58360694-58360716 GCAGGCCTAGGGGCTGGTATGGG - Intronic
1150246428 17:63679109-63679131 GCAACCCTCTGGCCAGGCATGGG + Intronic
1151880989 17:76894219-76894241 GCAGCCTTCTGGGCTGGGCGGGG + Intronic
1152379261 17:79934050-79934072 GCAGCCCTCAGGGCTGGCGGTGG - Exonic
1153820034 18:8825010-8825032 GCAGTGCTCTGGGCTGGTCATGG - Exonic
1154943007 18:21132877-21132899 GCCCCCCTCTGGGCTGGTTGAGG - Intergenic
1156789408 18:40953527-40953549 CTAGCCCTCTGGGCCTGTATGGG - Intergenic
1160163389 18:76491707-76491729 GCGGCCCTCTGGGCTGGGGGCGG - Intronic
1160880408 19:1317062-1317084 CCAGCCCTCTGGGCTGGATGCGG + Intergenic
1160907063 19:1456434-1456456 GCAGCTGTCTGGGCTGGAAGGGG + Intronic
1161032160 19:2062491-2062513 GCAGCCCTCAGGGCATGGATAGG + Intergenic
1161712478 19:5857000-5857022 GCTGCCCTCTGGGCTGAAAGAGG + Intergenic
1161749908 19:6088113-6088135 GCAGCACTCTGGGCTGGGAAGGG - Intronic
1161827037 19:6574932-6574954 GCTGCCCTCTGGGCTGAAAGAGG + Intergenic
1162378257 19:10317529-10317551 GCTGCCTTCTGGGCTGGGCTCGG + Exonic
1164208410 19:23076466-23076488 GCAGCCCTCTGGTCTTTTCTTGG + Intronic
1165110019 19:33496876-33496898 GCGGCCCTCGGGCCTGGTCTGGG - Intronic
1165393275 19:35550375-35550397 GCAGTCCTCTGGGCTGGCCTCGG - Exonic
1165901743 19:39172554-39172576 GCAGCCCTCGGGGCTGATTATGG + Intronic
1166223816 19:41382668-41382690 GAAGCCCTAGGGGCAGGTATTGG + Intronic
1166503813 19:43359360-43359382 GCAGCCCTCCAGGGTGGCATCGG + Intronic
1166506641 19:43375398-43375420 GCAGCCCTCCAGGGTGGCATCGG - Intergenic
1167669735 19:50843805-50843827 TCTGCGCTCTGGGCTGGTACTGG + Intergenic
925638754 2:5967583-5967605 GCAGCCCTCTGGGTGGATGTAGG + Intergenic
926906646 2:17811864-17811886 GGAGCCGTATGGGCTGGTAATGG + Intergenic
930091643 2:47535292-47535314 CCTGCCCTATGGGCTGGTAAAGG + Intronic
931535427 2:63271011-63271033 ACAGCCCTCTGGGCTGATGTTGG - Intronic
933648906 2:84833195-84833217 GCAGCTGTCTAGGCTGGTCTAGG - Intronic
936038383 2:109129955-109129977 GCCGCACTCTGGCCTGGGATGGG - Exonic
938854807 2:135298618-135298640 ACTGGCCTCTGGGCTGGTACTGG + Intronic
940037869 2:149329806-149329828 GCAGCCCTCTTGGGACGTATTGG - Intergenic
943288914 2:186042937-186042959 CTAGCCCTCTGGGCCAGTATGGG + Intergenic
944363410 2:198886581-198886603 GCAGCCCTCCTGGTTGGTATTGG - Intergenic
948970916 2:241426176-241426198 CCTGCCCTCTGCTCTGGTATTGG - Intronic
1169199077 20:3698972-3698994 GGAGCCCACAGGGCTGGCATTGG + Intronic
1170245693 20:14219823-14219845 GCCTGGCTCTGGGCTGGTATTGG + Intronic
1171453035 20:25248839-25248861 GCAGCCTTGTGGGTTGGAATGGG + Intronic
1173606948 20:44338137-44338159 CCATCCCTCTAGGCTGGTTTTGG - Intronic
1174197701 20:48785362-48785384 GGTGTCCTCTGGGCTGGTGTTGG - Intronic
1175268898 20:57720058-57720080 CCAGCCCTATGGGGTGGCATTGG + Intergenic
1175492464 20:59388503-59388525 GCAGCTCTCTGAGCAGGTAGGGG - Intergenic
1175846578 20:62062852-62062874 GCACCCCTTTGGGTAGGTATTGG - Intronic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
1176903321 21:14469797-14469819 GCAGTCTTCTTGGCTGGCATAGG - Intergenic
1177198579 21:17929546-17929568 GCAGCCTGCTGAGCTGGGATTGG + Intronic
1178579534 21:33826559-33826581 GGAGCCCTCTGGGCTCTTACAGG + Intronic
1180051740 21:45334881-45334903 ACAGGCCTCTCGGCTGGCATGGG - Intergenic
1180983471 22:19890623-19890645 GATGCCCTCTGTGCTGGTGTGGG - Intronic
1181463372 22:23098114-23098136 GCAGCCCTCTTGGCTCTTACTGG + Intronic
1182035200 22:27192840-27192862 GCAGCCCTCTTGGCTGAGACTGG + Intergenic
1183688121 22:39373844-39373866 GCAGAGCTGTGGGCTGGTCTGGG - Intronic
949806873 3:7964950-7964972 GCTGCTCTCTGGGCTGGGACTGG + Intergenic
950810433 3:15645431-15645453 GCTGTCCTCTGGGCTGGTGACGG + Exonic
951268388 3:20597241-20597263 GCTGGGCTCTGGGCTGGTAATGG + Intergenic
952824528 3:37513971-37513993 GCACCCCTCTGGGCCGGCACTGG + Intronic
952906892 3:38145577-38145599 GCAGAACACTGGGCTGGTAAGGG + Intergenic
953860569 3:46540826-46540848 GCAACCCTCTGGTGTGGTGTGGG - Intronic
954105313 3:48406698-48406720 GCAGCCCTGTGAGCTGGTTGGGG - Intronic
954381159 3:50219998-50220020 GGAGGCCGGTGGGCTGGTATGGG + Intronic
959592122 3:108091928-108091950 GCAGCCCTCTGCGCTGCGCTTGG + Intergenic
960047982 3:113215282-113215304 GGAGCCCTCAGGGTTGGTAACGG + Intronic
960257396 3:115525337-115525359 GAGGCACTCTGGGATGGTATAGG + Intergenic
960753673 3:120983753-120983775 GCAGCCTACTGGGCTGGGATAGG - Intronic
963794539 3:149618384-149618406 GCATCCATCTGTGCTGGTCTTGG + Intronic
964884404 3:161464692-161464714 GCAGCCATCTGGGTGGATATTGG + Intergenic
965532817 3:169791652-169791674 GCAGCCCTGGGAGATGGTATAGG + Intergenic
966830742 3:184006176-184006198 GGAGATCTCTGGGCTGCTATTGG + Intronic
975928637 4:79491469-79491491 ACTGGGCTCTGGGCTGGTATTGG + Intergenic
977220074 4:94327819-94327841 GCAGCCCTCTGGGTTGTTGTGGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
977926390 4:102705256-102705278 GCAGCCCCCAGGACTAGTATAGG + Intronic
978429690 4:108620689-108620711 GCAGTCCTTTGAGCTGGTGTAGG + Exonic
978549299 4:109907827-109907849 GCAACACTCTGGGGTGGAATTGG + Intergenic
978999358 4:115199035-115199057 GCCCAGCTCTGGGCTGGTATTGG + Intergenic
985589531 5:757388-757410 GCAGCCCCCTGGCCTGGTGCAGG - Intronic
986288399 5:6378225-6378247 CCAGCCCTCTGGTCTGGTCCCGG - Intronic
986338038 5:6769392-6769414 GCAGCCCACTGTGCAGGGATGGG + Intergenic
987183384 5:15389028-15389050 GCAGCCCACTGGCCTGTTAGGGG - Intergenic
987640185 5:20602218-20602240 ACGGGTCTCTGGGCTGGTATTGG - Intergenic
990237469 5:53783494-53783516 GCAGCCATCTGGGGTGGGGTAGG + Intergenic
990250557 5:53910120-53910142 GCAGCCCTGTGGGCAGTTGTTGG - Intronic
991253718 5:64592373-64592395 ACAGCCCTATGGGCTTGTAAAGG - Intronic
992086413 5:73281917-73281939 GCAGCCTTCAGGGCTGGTTCAGG + Intergenic
993690670 5:90996213-90996235 CCAGGCCTCTGGGCTTGTAATGG - Intronic
993728769 5:91398020-91398042 GCAGCCCCCAGGGCTGGTAGTGG + Intergenic
995075417 5:107977904-107977926 GCAGCTCTCTGGGCAGATGTAGG + Intronic
995116678 5:108488474-108488496 GCAACCCTCTGGGTGGATATGGG - Intergenic
997671735 5:135680054-135680076 GCAGCCTGCTTGGCTGGGATTGG - Intergenic
997700499 5:135894875-135894897 GCTGCCCTCTGGGCAGGTAGAGG - Intronic
998028285 5:138840008-138840030 GCAGCTTTCTTGGCTGGAATTGG + Intronic
998160959 5:139812821-139812843 GCAGCCCTCTAGGCCGGGCTGGG + Intronic
999316883 5:150590027-150590049 GCAGCCCTCTGCGCGGGCTTTGG - Intergenic
1002716978 5:181234049-181234071 GCTGGCCTCTGGGATGGTGTGGG + Intronic
1002786051 6:401478-401500 GCAGCCCTCGGGGCTGGACGTGG - Exonic
1002850923 6:995699-995721 TCAGCCCTCTGCGCTGTTCTTGG - Intergenic
1003123959 6:3340397-3340419 ACAGCCCTGTGGGCTGGCCTGGG + Intronic
1003256154 6:4476708-4476730 GGAGCCCTGAGGGCTGGTAGTGG - Intergenic
1003276865 6:4660930-4660952 CCAGCCCTCTTGGCTGGTCCTGG + Intergenic
1004838257 6:19553188-19553210 GCAGCTGTCTAGGCTGGTATAGG - Intergenic
1009350522 6:62671434-62671456 TCAGGCCTCTGGGCTTGGATTGG - Intergenic
1010717877 6:79250744-79250766 GCATCGCTATGGGCTGCTATTGG + Intergenic
1012205025 6:96450682-96450704 CCAGCCCTCTGGGGTGTTAAAGG + Intergenic
1014724130 6:124955387-124955409 GCAGCGCTCTGGGTTGTCATGGG - Intergenic
1017336615 6:153268676-153268698 GCAGCCTGTTGGGCTGGGATTGG + Intergenic
1018065853 6:160124781-160124803 GCAGCCATGTGGGCAGGTAGAGG + Intronic
1018192739 6:161324910-161324932 CCAGCCCTCTTGGCAGGTAGGGG + Intergenic
1019428585 7:988423-988445 GCAGCCCTCGGGGCCGGGGTGGG + Intronic
1019494894 7:1333243-1333265 GCAGCTGTCTGGCCTGGTACAGG + Intergenic
1019653363 7:2172771-2172793 GCAGCCAGCAGGGCTGGGATGGG - Intronic
1021858327 7:24880066-24880088 GCAGCCCACTGGGGTGGTGATGG + Intronic
1026846709 7:73702789-73702811 GCAGCCCTGGGTGCTGGTGTGGG + Intronic
1031568554 7:123329990-123330012 GCAGCCTTCTTGACTGGTGTAGG + Intergenic
1031889206 7:127274549-127274571 GCAGCCCTAAGGGATGGGATTGG - Intergenic
1034348198 7:150399718-150399740 GCAGCCCCTAGGGCTGGTGTCGG - Intronic
1034992975 7:155559768-155559790 GAAGCCCTAGGGGATGGTATTGG - Intergenic
1035363498 7:158329411-158329433 GCAGCACCCGGGGCTGGTTTCGG - Intronic
1036627544 8:10484006-10484028 GTACCCCTCTTGGCTGGCATGGG - Intergenic
1037442355 8:18929307-18929329 GTGGCCCTCTGGGCTTGTTTGGG - Intronic
1039633109 8:39134116-39134138 GCAGCCCTCTGGGTGGACATGGG + Intronic
1039639810 8:39206755-39206777 GCAGCCCTCTGGGTGGATGTGGG + Intronic
1039673626 8:39634009-39634031 CCAGCACTCTGGGCTTGTAATGG - Intronic
1040299082 8:46178663-46178685 GTAGCCCCCAGGGCTGGGATGGG + Intergenic
1041194476 8:55387247-55387269 TCAGCCCTCTGGGCTGTCCTTGG + Intronic
1041830409 8:62147247-62147269 GCAGCCTGCTTGGCTGGGATTGG + Intergenic
1044599055 8:93985552-93985574 ACAGCCCTGTGGGCCGGTAGTGG + Intergenic
1046121179 8:109848833-109848855 GCAGCCCTCTGGGTGGATGTGGG + Intergenic
1047510208 8:125510004-125510026 GGAGCCCTCTGGGCTGCTGTAGG + Intergenic
1049378118 8:142298616-142298638 GCAGCCCTCTGTGGGGGTTTGGG + Intronic
1049655642 8:143795736-143795758 GCAGCCCTGTGAGCTGTGATGGG - Intronic
1051179470 9:14395428-14395450 CCAGCTCTCAGAGCTGGTATTGG - Intronic
1051800390 9:20926375-20926397 GTTGCCCTCTGGGTTGGTAATGG - Exonic
1056661069 9:88543845-88543867 GCAGCTCTCTGGTGTGGAATTGG + Intronic
1056699515 9:88890555-88890577 CCAGCTCTCTGGGCTGGGGTTGG + Intergenic
1057019877 9:91688946-91688968 TCAGTCCTGTGGGCTGGTTTGGG + Intronic
1057823484 9:98352863-98352885 GCAGCCCTCTGGGTGGATGTGGG + Intronic
1059609529 9:115877938-115877960 GCCCCGCTCTGGGCTGGTAATGG + Intergenic
1060311118 9:122463724-122463746 ACTGGGCTCTGGGCTGGTATAGG + Intergenic
1061565419 9:131436039-131436061 TCAGCCCTCTGAGTAGGTATGGG + Intronic
1062267316 9:135693097-135693119 GGAGCCCCCTGGGCTGGGAGAGG + Intergenic
1187326377 X:18294656-18294678 GCAGCCCTCTGGGTGGATGTTGG - Intronic
1187963195 X:24585659-24585681 GGAGCACTCTGGCCTGGCATGGG - Intronic
1190061961 X:47217529-47217551 GCAGCCCTTTGAGCTGGACTTGG + Intergenic
1190482292 X:50889568-50889590 GCAACCCTCTGGGTGGGTGTAGG - Intergenic
1192691161 X:73366467-73366489 ACAGGGCTCTGGGCTGGTACTGG + Intergenic
1193424632 X:81327555-81327577 CCAGGCCTCTGGGCTTGTGTTGG - Intergenic
1193943568 X:87706154-87706176 GCAGCCCGCTAGGCAGGGATTGG + Intergenic
1194214364 X:91110411-91110433 ACTGGCCTCTGGGCTGGTGTTGG + Intergenic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1198943221 X:141981837-141981859 ACAGGGCTCTGGGCTGGTACTGG + Intergenic
1200011164 X:153122097-153122119 GCAGCTCCCTGGGAAGGTATGGG + Intergenic
1200028435 X:153277825-153277847 GCAGCTCCCTGGGAAGGTATGGG - Intergenic
1201390355 Y:13490570-13490592 GCAGCCTGCTTGGCTGGGATTGG - Intergenic