ID: 907424294

View in Genome Browser
Species Human (GRCh38)
Location 1:54369368-54369390
Sequence CCTCTCATCTCCCCCAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907424294_907424301 25 Left 907424294 1:54369368-54369390 CCATTGCTGGGGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 335
Right 907424301 1:54369416-54369438 AAAAGGCATCTTGAAAACCAAGG No data
907424294_907424300 8 Left 907424294 1:54369368-54369390 CCATTGCTGGGGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 335
Right 907424300 1:54369399-54369421 AGCTAGGTGGATGGATAAAAAGG 0: 1
1: 0
2: 3
3: 27
4: 357
907424294_907424299 -1 Left 907424294 1:54369368-54369390 CCATTGCTGGGGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 335
Right 907424299 1:54369390-54369412 GGACTGTGCAGCTAGGTGGATGG 0: 1
1: 0
2: 0
3: 22
4: 236
907424294_907424297 -8 Left 907424294 1:54369368-54369390 CCATTGCTGGGGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 335
Right 907424297 1:54369383-54369405 ATGAGAGGGACTGTGCAGCTAGG 0: 1
1: 1
2: 2
3: 17
4: 941
907424294_907424298 -5 Left 907424294 1:54369368-54369390 CCATTGCTGGGGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 335
Right 907424298 1:54369386-54369408 AGAGGGACTGTGCAGCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907424294 Original CRISPR CCTCTCATCTCCCCCAGCAA TGG (reversed) Intronic
900524518 1:3121935-3121957 GCTCTAATCTCCCCGAACAAAGG + Intronic
900737379 1:4307658-4307680 CCTCTCCTCTGCTCCAGCACTGG - Intergenic
901592134 1:10353439-10353461 CCTCTTACCTCACCCAGGAAGGG + Intronic
901796204 1:11681019-11681041 CCTCTCCCCTCCCCCAGTACCGG + Exonic
903024520 1:20417939-20417961 CCTCTGTGCTCCCCCAGCAGTGG - Intergenic
903362685 1:22786698-22786720 CCTCTCCTCTTCCCCAGCACAGG - Intronic
904321149 1:29698474-29698496 CCTCAGCTCTCCCCCAGAAAAGG + Intergenic
904926861 1:34056257-34056279 CCTCTAATCTCTCCCAGCTCTGG + Intronic
905277191 1:36825893-36825915 CCTCATCTCTCCTCCAGCAATGG - Intronic
905372636 1:37492394-37492416 CCACTCCTCCCTCCCAGCAAAGG + Intergenic
905651912 1:39662301-39662323 CCTCTCAGCTCTGCCAGCACTGG + Intronic
905891520 1:41521387-41521409 CCTCTCCTCTGCCCCCGCCACGG + Intronic
906315996 1:44786757-44786779 CGCCTCACCTCCCCCAGCAAAGG + Intronic
906353042 1:45080025-45080047 CCTCTCCTCTCCTCGAGCAAAGG + Intronic
906369200 1:45237827-45237849 CCTCCTTTCTCCCCCACCAAAGG - Intronic
907424294 1:54369368-54369390 CCTCTCATCTCCCCCAGCAATGG - Intronic
907930980 1:58999985-59000007 CCTCGCATCTTCACCAGCATCGG + Intergenic
908396710 1:63731725-63731747 CATCTCAGCTCCCCCAGTCAAGG + Intergenic
908926270 1:69258686-69258708 ACTCACATCTTCCCCAACAAAGG - Intergenic
909644355 1:77899738-77899760 CCTTTCATCTCCCCAAGCTTAGG + Intronic
913050756 1:115114933-115114955 GTTCTCATCTCCCCCATCAGAGG + Intergenic
913192123 1:116421722-116421744 TCTTCCATCTCCTCCAGCAATGG - Intergenic
914895436 1:151667499-151667521 CCTCTCCTCTTACCCAGCTATGG - Intronic
915101276 1:153502575-153502597 CCTCCCATCCCACCCACCAAAGG - Intergenic
915508447 1:156372091-156372113 CCTTTCATCTCCCGAATCAAAGG - Intronic
915509956 1:156381482-156381504 CCTCCCATCTTCCCCTACAAGGG - Exonic
915589945 1:156864944-156864966 CCTCCCATCTCCCTCAGGGATGG + Intronic
915734358 1:158075349-158075371 CCTCTCAGCTCCCACAGTGAAGG + Intronic
916450057 1:164912297-164912319 CCTCTCACCTTCAGCAGCAATGG + Intergenic
917191315 1:172422228-172422250 CCTCTTCTCTCCTCAAGCAAAGG - Intronic
917796410 1:178535944-178535966 CCACTCTCCTGCCCCAGCAATGG - Intronic
918177308 1:182057499-182057521 CCACCCAGCTTCCCCAGCAATGG - Exonic
919161874 1:193840702-193840724 CCGCTCACCTGCCCCAGCCATGG - Intergenic
919940607 1:202283516-202283538 TCTCTCATCTCCGGCAGCAGAGG + Intronic
922161807 1:223083698-223083720 CCTCTCTGCTCCCACAGCAATGG - Intergenic
1063077036 10:2727754-2727776 CCTCTCATTGCCCCTTGCAAAGG - Intergenic
1065184402 10:23157879-23157901 CCTGTCGCCTCCCACAGCAAGGG + Intergenic
1065231748 10:23605700-23605722 ACCCCCATCTCCACCAGCAAAGG + Intergenic
1067236838 10:44458355-44458377 TCTCCCATCTCTCCCAGCTAGGG - Intergenic
1070401310 10:76055861-76055883 CCTAACAGCTCCCCAAGCAAAGG - Intronic
1070794764 10:79210139-79210161 CCTCACTTCTACCCCAGCAGAGG + Intronic
1074793092 10:116912288-116912310 TCTCTCAGCTCCACCAGCTATGG + Intronic
1075025158 10:118978817-118978839 CCTCTTATCTCCCACTGCAGCGG + Intergenic
1075088330 10:119428903-119428925 CCACTCATTTCCCCCAGCAGAGG + Intronic
1076335693 10:129704992-129705014 CCCCACATCTCCCCCAACAATGG + Intronic
1077907224 11:6544055-6544077 CCTCTTCTCTCCCCCAGCCCCGG + Intronic
1078927628 11:15888855-15888877 ACCCTGATCTCTCCCAGCAAAGG + Intergenic
1079209759 11:18450403-18450425 CCTCTCATCACCAGCTGCAATGG - Intronic
1079532949 11:21477200-21477222 CCTCTCCTTTCCTCAAGCAAAGG - Intronic
1079899284 11:26161239-26161261 CCTCTCCCCTCCTCTAGCAAAGG + Intergenic
1080038325 11:27732527-27732549 CCAGTCATCTGCCCAAGCAAAGG + Intergenic
1083153823 11:60810385-60810407 CCTCCCACCTCCCCTAGAAAGGG + Intergenic
1083283434 11:61641853-61641875 CCCCTCACCTCCCTCAGCAAAGG + Intergenic
1083346586 11:61997639-61997661 GCTCTCATCTCCCTAAACAAGGG - Intergenic
1084307458 11:68296392-68296414 CCTCTCACATCCCTCAGCCAGGG - Intergenic
1087068939 11:94055642-94055664 CCTCACATCTTCACCAGCATTGG - Intronic
1088119555 11:106352086-106352108 CATTTCATTTCCCCCAGAAATGG - Intergenic
1088375848 11:109140880-109140902 CCTCTCCTCTCCTCAAGCAGAGG + Intergenic
1088960789 11:114662642-114662664 CCTCTCCTCCCCTCAAGCAAAGG - Intergenic
1089330176 11:117683874-117683896 CCTGTCATCACCCCCACCCAGGG + Intronic
1089580347 11:119477791-119477813 CCTCTCTTCACCCCCAGACAAGG - Intergenic
1089847086 11:121466789-121466811 CCTGACATCTCGCCAAGCAAAGG + Intronic
1091238844 11:134039226-134039248 CCTCTCACCCCTCCCAGGAAAGG - Intergenic
1091684705 12:2553438-2553460 CATCTCATCTCCCAAAGCAAGGG + Intronic
1091698544 12:2644254-2644276 CCTCTGATCTCCTCCAGGGAAGG - Intronic
1093537807 12:20243688-20243710 CCTCTCCCATCCCCCAGCAGCGG + Intergenic
1095310832 12:40694213-40694235 CCTCACATCTACCCCCGCAAGGG - Intronic
1095944532 12:47746495-47746517 CCTCTGAGCTCCCACAGCACTGG + Intronic
1096377463 12:51125082-51125104 CCTCGCATCTTCACCAGCATCGG - Intronic
1096504036 12:52081637-52081659 CCCACCCTCTCCCCCAGCAAAGG - Intergenic
1097279640 12:57836932-57836954 CCTCCCATCCCCCACAGCAAAGG + Intronic
1098736681 12:74113429-74113451 CATCTCCTCTCCTCAAGCAAAGG + Intergenic
1099021312 12:77407959-77407981 CCTCTCTTCTGCCTCAGTAATGG + Intergenic
1099549508 12:84025360-84025382 CCTCTCATTTCCTTCAGCACTGG - Intergenic
1100617598 12:96242982-96243004 CCTCTCTGCTCCCCCAGCAGAGG + Intronic
1102053451 12:109879714-109879736 ACTCCCATCTCCCCCTCCAAGGG - Intronic
1102492929 12:113299640-113299662 CCTCAGATCTCCAGCAGCAAGGG + Exonic
1102719193 12:115001904-115001926 TCTCTTCTCTTCCCCAGCAAGGG + Intergenic
1102739062 12:115190037-115190059 TCTCTCATCTCCCCAGGGAAAGG + Intergenic
1103571333 12:121847019-121847041 GCTCCCCTCTCCCCCAGCCAGGG + Intronic
1104683850 12:130771541-130771563 CCTCACAGCTCCCACAGCCAGGG + Intergenic
1105317606 13:19281210-19281232 CCTCTCATTTCCTTGAGCAATGG - Intergenic
1107445558 13:40467457-40467479 CCTCACAACTTCCACAGCAATGG + Intergenic
1107754104 13:43600441-43600463 CCTCTCCTTTCCACCAGCAGAGG - Intronic
1109083985 13:57946465-57946487 CCTACCACCACCCCCAGCAAGGG - Intergenic
1109153789 13:58878451-58878473 CCTCTAATCTGCCTCAGTAAGGG - Intergenic
1109701477 13:66030539-66030561 TATCTCATCTCCCCCATAAAAGG - Intergenic
1109798600 13:67346318-67346340 TCTCTCATCTCCTCCAGGAGGGG + Intergenic
1110855999 13:80297265-80297287 CCTCTCACTTCCCCCAGAGAAGG + Intergenic
1110886043 13:80636821-80636843 CCTCTCATTTCCACAAGCAGAGG + Intergenic
1113255012 13:108496291-108496313 TCCCCCATCTCCCCTAGCAACGG - Intergenic
1113880245 13:113621337-113621359 CCGCTCAGCTCCCCCAGCCGTGG + Intronic
1113992017 14:16035402-16035424 CCCCGCTTCTCCCCCAGCCAAGG + Intergenic
1114517503 14:23309204-23309226 CCTCCCACCTCCCCCAGCCCTGG - Exonic
1115519540 14:34219646-34219668 CCACTCCTCTCCCCCAGTGAAGG + Intronic
1115660946 14:35494005-35494027 ACTCTCCTCTCCTCCGGCAAAGG - Intergenic
1116057818 14:39885626-39885648 CCTCTCTTCTCCTCAAGCACAGG - Intergenic
1116079352 14:40153990-40154012 CCTCTCCTCTCCTCAAGCAAAGG - Intergenic
1117581725 14:57158044-57158066 CCTCTCCACTCCCCCAGCCTAGG + Intergenic
1117734097 14:58751806-58751828 CCTAGGATCTCCCCCAGCCAGGG + Intergenic
1117795480 14:59388965-59388987 CCTCTCTTCTCCTCAAGCAGAGG + Intergenic
1120857263 14:89223352-89223374 CCTCCCCTTTCCCACAGCAAAGG + Intronic
1122480398 14:102043470-102043492 AATCTCCTCTCCCCCAGCACAGG + Intronic
1123998346 15:25734175-25734197 CCTCTCGTCCACCCCAGCAGAGG + Intronic
1126486660 15:49188490-49188512 ACTCTCTTAACCCCCAGCAATGG - Intronic
1126624318 15:50671563-50671585 CCTCTCATCTCCTCCTCCCACGG - Intronic
1128225978 15:66001645-66001667 TCTCTCATCTCCCCTCTCAATGG + Intronic
1128233443 15:66051219-66051241 CCTCTCTGCTCCCCCAGCTGAGG - Intronic
1128345777 15:66851611-66851633 CCTCTCACCCCTCCCAGCAACGG + Intergenic
1128522767 15:68386524-68386546 ACTCTCATCGCCCTCAGCCATGG - Intronic
1129200497 15:73995498-73995520 CCTCCCACCTCCCCCGACAAAGG + Intronic
1129709651 15:77814021-77814043 TTTCTCATCTGCCCCAGCACAGG - Intronic
1131270964 15:90947466-90947488 CCTCTCAACTCCACCTGCAGAGG + Intronic
1131578202 15:93613453-93613475 TCTCGCATCTCCCCCACCATAGG - Intergenic
1131979212 15:97979459-97979481 CCTCTCTTCTTGCCCAGCCAGGG + Intergenic
1132317692 15:100901804-100901826 CCTCCCTTCTTCCCCAGCCAGGG - Intronic
1132618425 16:853304-853326 CCTCCCCTCTCCCCCAGCCTGGG - Intergenic
1134568175 16:15268978-15269000 CCTCTCTTTGCCCCCATCAAGGG - Intergenic
1134734258 16:16487377-16487399 CCTCTCTTTGCCCCCATCAAGGG + Intergenic
1134933243 16:18224902-18224924 CCTCTCTTTGCCCCCATCAAGGG - Intergenic
1135711750 16:24723186-24723208 CTTCTCATCCTCCACAGCAATGG + Intergenic
1136004217 16:27317473-27317495 CCTCTCTTCTAGCCCAGCCATGG - Intronic
1136103699 16:28013674-28013696 CATTTCATCTCCCACAGCATGGG + Intronic
1136504962 16:30697365-30697387 CCTCCCATCACCCCCAGAAGAGG - Intergenic
1136690485 16:32024961-32024983 CCCCTCACCTCCCCCACAAAGGG + Intergenic
1137711644 16:50571067-50571089 CCTCTCAGCTCTCCCTTCAAAGG - Intronic
1137747211 16:50831302-50831324 ACTCTCATCTCCCACAGCTGGGG - Intergenic
1139482040 16:67236068-67236090 CCTCTCATCCCCCCTACCCAGGG - Intronic
1141009878 16:80387467-80387489 CCCCACATTACCCCCAGCAAAGG + Intergenic
1141052618 16:80785442-80785464 CCTCTCATTTCCTCGAGCAGTGG - Intronic
1142896579 17:2983054-2983076 CTTCGCAGCTCCCCCAGCGACGG - Intronic
1145062325 17:19741057-19741079 CCTCTCATCCCACCCTGCCAAGG + Intronic
1146559054 17:33852369-33852391 CCTCTGATCTCCACCAGAAAGGG - Intronic
1146871699 17:36381532-36381554 CCTCTCATCCCCATCAGCAGAGG - Intronic
1146879058 17:36432614-36432636 CCTCTCATCCCCATCAGCAGAGG - Intronic
1146882998 17:36453760-36453782 CCTCTCATCCCCATCAGCAGAGG - Intergenic
1147067687 17:37931348-37931370 CCTCTCATCCCCATCAGCAGAGG + Intronic
1147074585 17:37982156-37982178 CCTCTCATCCCCATCAGCAGAGG - Intronic
1147079218 17:38010903-38010925 CCTCTCATCCCCATCAGCAGAGG + Intronic
1147086108 17:38061695-38061717 CCTCTCATCCCCATCAGCAGAGG - Intronic
1147095157 17:38134845-38134867 CCTCTCATCCCCATCAGCAGAGG + Intergenic
1147102053 17:38185660-38185682 CCTCTCATCCCCATCAGCAGAGG - Intergenic
1147423016 17:40331921-40331943 CCTCTCATCCTCCCCACAAAGGG - Intronic
1147755936 17:42767845-42767867 CCTCTCCTCTCCCTCAGCCCTGG - Intergenic
1148160499 17:45447259-45447281 TCTCTCACCTCCCCCAGCAATGG + Intronic
1148670918 17:49409392-49409414 CCTCGCATCTTCACCAGCATCGG - Exonic
1149846645 17:60012171-60012193 CCTCTCATCCCCATCAGCAGAGG - Intergenic
1150084991 17:62268745-62268767 CCTCTCATCCCCATCAGCAGAGG - Intergenic
1150391788 17:64794139-64794161 TCTCTCACCTCCCCCCGCAATGG + Intergenic
1150541379 17:66103764-66103786 CTTCTCCTATCCCCCAGCAGTGG + Intronic
1150714904 17:67563852-67563874 CCCCACATCTCCCCCACCATTGG - Intronic
1150904898 17:69326978-69327000 CCCCTCAACTCCCCCAGGGACGG + Intronic
1151956179 17:77381289-77381311 CCTCTCCCCTCCCCCAGGCAGGG + Intronic
1153699584 18:7679023-7679045 CCTCACATCTTGCCCAGCAGTGG + Intronic
1153933571 18:9900765-9900787 CCTCTCATCCCAGGCAGCAAAGG + Intergenic
1155157529 18:23170015-23170037 CCTCTCAGCTCCCCCTGCTCTGG + Intronic
1155239615 18:23853124-23853146 CCTCCCATGTCCCCTAACAAAGG + Intronic
1157387338 18:47268949-47268971 CCTCTAATCTCTTCCAGCACTGG + Intergenic
1158557435 18:58486904-58486926 GCTCTCCTCTACCCAAGCAATGG + Intronic
1160086399 18:75780932-75780954 CCCGTCATCTCCCACAGAAACGG + Intergenic
1162452607 19:10763998-10764020 CCACCCACCTCCCCCAGCAAGGG - Intronic
1162523287 19:11194238-11194260 CCTCTCAAATCCCCCAGGACAGG + Intronic
1162858319 19:13486993-13487015 CATCCCATTTCCCCCAGCCAGGG - Intronic
1163319850 19:16568248-16568270 CCCCTCTCCTCCCTCAGCAAAGG + Intronic
1163553530 19:17979639-17979661 CCCCTCATCTCCCCTAGGACTGG + Intronic
1163585835 19:18162950-18162972 CCCCTCTCCTCCCCCAGGAAAGG + Exonic
1163861751 19:19746623-19746645 CCTCTCATCCCCATCAGCAGAGG + Intergenic
1165673206 19:37697071-37697093 CCTCGCATCTTCACCAGCATTGG - Exonic
1167230241 19:48278365-48278387 TCCCTCATCTCCCCCAGCCCTGG + Intronic
927256525 2:21044574-21044596 TCTCTCTCCTCCCCCAGCACGGG - Intergenic
929775509 2:44928859-44928881 CCCCTCATCTTCCCCAGCTCCGG - Intergenic
929884071 2:45863009-45863031 GCTCTCTTCTCCTCCAGCAGTGG - Intronic
930107329 2:47650459-47650481 CCCCTCTTCTTCCTCAGCAAAGG + Intergenic
931012228 2:57929963-57929985 CCTCTCCTCTCCTCAAGCAGAGG + Intronic
931844005 2:66183962-66183984 CCACCTATCTCTCCCAGCAAAGG - Intergenic
932436902 2:71707221-71707243 TCTCCCATCTCCCCCAGGAGGGG - Intergenic
932925108 2:75964351-75964373 CCCCTCAACTACCCCAGCCATGG - Intergenic
934680024 2:96276983-96277005 CCCCTCCTCTCCCCCTGCAGTGG - Exonic
935576630 2:104717820-104717842 CCTCTCCTCTCCTCAAGCAAAGG + Intergenic
936079523 2:109422891-109422913 CCTGTCATCACCTACAGCAATGG + Intronic
936611305 2:114004736-114004758 CCCCTCAGCTTCCACAGCAAAGG - Intergenic
936940445 2:117878881-117878903 CCTCTCTTCTCCTCAAGCAAAGG + Intergenic
936980032 2:118255686-118255708 CCTCTCACTCCCCCCAGCTATGG + Intergenic
937533465 2:122857762-122857784 CCTCTAACCTCCCTCAGGAAGGG - Intergenic
938192804 2:129299157-129299179 CCGCTCATTTCCTCCAGCCATGG - Intergenic
938539708 2:132275852-132275874 CCTCGCTTCTCCCCCAGCCAAGG - Intergenic
939084383 2:137700453-137700475 CCTCTCATTTCCTCAAGCAGTGG - Intergenic
939187578 2:138878712-138878734 CCACTCATCTCCACCACCAGTGG - Intergenic
939273480 2:139970267-139970289 CCTGTCACATCCCCCGGCAATGG + Intergenic
939625964 2:144477815-144477837 CTCCTCATCTCCATCAGCAAAGG - Intronic
940782093 2:157943519-157943541 CTTTTCATCTCCTCTAGCAAAGG - Intronic
942294868 2:174507549-174507571 CCTCTTCTCTCCTCAAGCAATGG - Intergenic
943099671 2:183472283-183472305 CCTCCCATATCCACCAGCAATGG - Intergenic
943302605 2:186222940-186222962 CCTCCCCTATCCCCCAGCAGTGG + Intergenic
943473884 2:188330833-188330855 TCTCTCAGCTCCCCCGACAATGG + Intronic
943911545 2:193574690-193574712 CTTCTCATTTCCCTCAGCATAGG + Intergenic
945014604 2:205502100-205502122 CCTCTCCTCTCCCCACGCCAAGG + Intronic
946009628 2:216554376-216554398 CCTCTCACCCACCCCACCAAAGG - Intronic
946166407 2:217866786-217866808 CCTCTCCCCTCCCCCATCACTGG + Intronic
946381452 2:219351715-219351737 CCTCTCAGCGACCCCAGTAAAGG - Intergenic
946766471 2:223045268-223045290 CCCCACATCTTCCCCAGGAAGGG + Intergenic
947136163 2:226978767-226978789 CCTCTGATCACCCCCAGTGAGGG - Intronic
948249364 2:236513252-236513274 CCTCCCATTTCCCCCAGTAACGG + Intergenic
948304847 2:236939126-236939148 TCTCTAATCTCCCACTGCAACGG + Intergenic
948750004 2:240126599-240126621 CCCTTCTTCTCCACCAGCAACGG + Exonic
948903143 2:240966135-240966157 CCTCTCTGCTGCCCCAGCCATGG - Intronic
1169022594 20:2340734-2340756 CCTCTCCTCTCCCCCAGGTTGGG + Exonic
1169067397 20:2701745-2701767 CCTGTCATCTAGCCCAGCGAAGG - Intronic
1171906683 20:30905270-30905292 CCCCTCTTCTCCCCCAGCCAAGG + Intergenic
1172304236 20:33870297-33870319 CCTCTCCTCTCCCACAGGGAGGG - Intergenic
1172386950 20:34540762-34540784 CGGCTCTTCTCCCCCACCAACGG + Exonic
1172418883 20:34797221-34797243 CCTCTCCTCTCCTCAAGCAGAGG - Intronic
1173540403 20:43846883-43846905 GCTCTCATCTCTCACAGAAAGGG - Intergenic
1174085361 20:48004257-48004279 CTTCTCATTTCCACAAGCAAAGG - Intergenic
1174280236 20:49433935-49433957 CCTCTCCTCTCCTCCTGCCAGGG + Intronic
1174342420 20:49906223-49906245 CCACCCGCCTCCCCCAGCAACGG - Exonic
1175828830 20:61951116-61951138 CCTCTCCCCTCCCCCAGCCCTGG + Intergenic
1175828849 20:61951151-61951173 CCTCTCCCCTCCCCCAGCCCTGG + Intergenic
1176994844 21:15543599-15543621 TCTCTCCCATCCCCCAGCAATGG + Intergenic
1177298013 21:19202321-19202343 CCTTCCTTATCCCCCAGCAATGG + Intergenic
1179547021 21:42119285-42119307 CCTCTGATCACCTCCAGCAGAGG - Exonic
1180084944 21:45504336-45504358 CCTCCCATCCCCCCGAGCCAGGG - Intronic
1180315253 22:11272125-11272147 CCCCGCTTCTCCCCCAGCCAAGG - Intergenic
1180340094 22:11611345-11611367 CCCCGCTTCTCCCCCAGCCAAGG + Intergenic
1181757182 22:25032264-25032286 CCTCTTATCTGCCCCATAAAAGG + Intronic
1182437048 22:30337497-30337519 CCTCTCATTTCTACCAGGAACGG + Intronic
1183723018 22:39573221-39573243 CTTGTCATCTCACCCAGGAAAGG - Intronic
1183832464 22:40425609-40425631 CCCCTCATCTGTCCCAGCAGGGG + Intronic
1183933351 22:41248506-41248528 GCTCTGGGCTCCCCCAGCAAAGG + Intronic
1184827981 22:46965978-46966000 CCTCACACCTCCCGCAGCCATGG + Intronic
1185040206 22:48500049-48500071 CCCCTCATCTTACCAAGCAAAGG - Intronic
952327613 3:32335244-32335266 TCTCTCAGCTCTCCCAGGAAAGG - Intronic
952969371 3:38641235-38641257 TCTCCCATCTCCCCCAGAACTGG - Intronic
953905484 3:46866389-46866411 CCTCTCCCTTCCCCCAGCCAAGG + Intronic
954720500 3:52558063-52558085 CCTCCCTTCTGCCCCAGAAATGG - Intronic
954756028 3:52840465-52840487 CCTCCCGTCACCCCCAGCATGGG + Exonic
954811678 3:53252166-53252188 CCTGTGAGCTCCCCCAGAAAAGG + Intronic
956176307 3:66476372-66476394 CCTCTCCTCTCCCCCAGATAAGG + Intronic
956476059 3:69621486-69621508 CCTCTCCTCTCCTCAAGCAGTGG - Intergenic
957888125 3:86317356-86317378 CTTCTCATCTACTCCAGCCAGGG - Intergenic
959127466 3:102307663-102307685 CCTCTCCTCTCCTCAAGCTAAGG - Intronic
959742929 3:109741735-109741757 CCTCTCAGTTCCCCAAGCAGAGG - Intergenic
961040045 3:123671815-123671837 CATCTGGTCTCCCCCACCAAAGG - Intronic
961464074 3:127070928-127070950 CATCCCATCTCCCCCAGCCTTGG - Intergenic
961602125 3:128070483-128070505 CCTCGCAGCTGCCCTAGCAAGGG + Exonic
961728821 3:128952036-128952058 TCTCTCATCTCCCCCTCCACAGG + Intronic
961869536 3:129977474-129977496 CCTCTCACCCCCCCCACCACAGG + Exonic
962025432 3:131542405-131542427 CAGGTCATCTCCCACAGCAAGGG + Intronic
963170270 3:142243225-142243247 CCTCTGGTCTCCACCAGCCAGGG + Intergenic
964952824 3:162317585-162317607 CCTCACCTCTCCTCAAGCAAAGG + Intergenic
965360685 3:167735085-167735107 CATCTCACCTCCTCCCGCAAAGG - Intergenic
966736346 3:183189994-183190016 CCTCTCATCTCCTACAGCAGAGG - Intronic
968035512 3:195544410-195544432 CCTCTCACCCCCCACAGCAGTGG - Intergenic
969189842 4:5508550-5508572 TCTCTCAGCTTCCCCAACAAGGG - Intergenic
969530019 4:7725416-7725438 CCTCTCAACTGCCCCAGGAGGGG - Intronic
970106522 4:12592120-12592142 CCTCTCATCTTCACTAGCATCGG - Intergenic
971418115 4:26452203-26452225 CCCCTCACCTCCTCCACCAAGGG - Intergenic
971914681 4:32852066-32852088 CCTCTCCAATCCCCCAGCAATGG - Intergenic
973573748 4:52265485-52265507 TCTCTCAGCTCTCCCAGCATCGG - Intergenic
975113982 4:70658773-70658795 CTTCTCCTCTCCCCCAGGATTGG + Intronic
976722105 4:88178805-88178827 CCTCTCATTTCCACAAGCAGAGG - Intronic
977307405 4:95342257-95342279 CCTCTCCTCTCCTCAAGCAGAGG - Intronic
977981568 4:103329229-103329251 CCCATCATCTCCCCTAACAATGG - Intergenic
980176496 4:129352081-129352103 CCTCTCCTCTCCCTCTGCAGTGG - Intergenic
980578384 4:134715118-134715140 CCTCTCATTTCCTCAAGCAGTGG - Intergenic
984516251 4:180744469-180744491 CCTGTCATTTCCCCATGCAAGGG + Intergenic
984784725 4:183556999-183557021 CCTCACATCACCCCCATAAACGG + Intergenic
984824280 4:183910500-183910522 CCTCTCCCCTCCCCCAGCCCTGG + Intronic
985885696 5:2676104-2676126 CCTCTGAGGTCTCCCAGCAAGGG + Intergenic
986699669 5:10393481-10393503 CCTCTGACCTCCCCCTGCAAAGG - Intronic
986983984 5:13479806-13479828 CAACTCCTCACCCCCAGCAAGGG + Intergenic
987076291 5:14385114-14385136 CTGCTCCACTCCCCCAGCAACGG - Intronic
987772854 5:22329652-22329674 CCTCTCTCATCCCCCAGCAGCGG + Intronic
988082609 5:26432981-26433003 CCTCCCACATCCCCCAGCAGTGG + Intergenic
988455300 5:31382007-31382029 TCTCTCCTCTCCTCCAGCATGGG - Intergenic
989671767 5:43925391-43925413 CCTCTCCTCTCCTCAAGCAGAGG + Intergenic
990202911 5:53397916-53397938 CCTCTCCTTTCCTCTAGCAAAGG + Intergenic
990886547 5:60600912-60600934 CCTCCCATCTCCCACAGCAAGGG - Intronic
992877960 5:81076447-81076469 CCTCCCATCTGCCCCATCAGCGG - Intronic
992877982 5:81076574-81076596 CCTCCCATCTGCCCCATCAGCGG - Intronic
992878003 5:81076701-81076723 CCTCCCATCTGCCCCATCAGTGG - Intronic
993195198 5:84733178-84733200 CCTCTTATCTGACACAGCAAGGG + Intergenic
994126944 5:96178733-96178755 CCTCTGATTTTCCCCAGGAAGGG - Intergenic
994614689 5:102089548-102089570 CCTCTCCTACCCCCCAGCAGTGG - Intergenic
995019654 5:107352480-107352502 CCTCTCCTCTCCTCAAGCAGAGG + Intergenic
995366903 5:111372290-111372312 CCTCCCATCTCCCTCAACCATGG + Intronic
996459406 5:123724673-123724695 CCTCTCTCATCCCCCAGCAATGG + Intergenic
996550724 5:124727246-124727268 CCTCTCCTCTCCCCAAGTCAAGG + Intronic
996944977 5:129055820-129055842 CCTCTCTTCTCCTCAAGCATAGG - Intergenic
997103157 5:130990731-130990753 CCTCTCATCACCCCCAGGTAAGG - Intergenic
997998201 5:138603415-138603437 GCTCTCATCTTCTCCTGCAATGG - Intergenic
998059014 5:139104533-139104555 CCTCTCCTCTCCCCTAGCAGAGG + Intronic
998066606 5:139164392-139164414 CCGCTCACCTTCCCCAGTAAGGG + Intronic
998939443 5:147264821-147264843 CTTCTAATCTCTCCCAGCCAAGG - Intronic
999231574 5:150065148-150065170 CCTCCCATCCTCCCCACCAAAGG + Intronic
999728777 5:154459629-154459651 CCTCTCCTCTCCCCAAGCTTTGG - Exonic
999849616 5:155523960-155523982 CCTCCCCTTTCCCCCAGCAGTGG - Intergenic
1000330248 5:160199929-160199951 CCTCCCACCTACCCCAGCCAGGG + Intronic
1001343851 5:170872180-170872202 CCTCTCATTTCCTCGAGCAGTGG + Intronic
1004029536 6:11852801-11852823 CCTCTCATTTCTCCCAGCTCAGG - Intergenic
1006316220 6:33293452-33293474 CGCCTCATCTCCCCCAGTACTGG + Exonic
1006511560 6:34524290-34524312 CCTCAGCTCTCCCCCAGCACAGG + Intronic
1006635249 6:35457155-35457177 CCTCTCTTCTCCCCCAGGCTGGG + Intronic
1007322958 6:41040479-41040501 CCTCTCACCTCCACCAGGGAAGG - Intronic
1007819139 6:44547693-44547715 TCCCTCATCTTCCCCAGCAGTGG + Intergenic
1008290242 6:49706055-49706077 TCTGCCATTTCCCCCAGCAAGGG + Intronic
1009852392 6:69214129-69214151 CCTCTCCTCTACCCCTGCATGGG - Intronic
1010625341 6:78131591-78131613 ACTCTCCTCTGGCCCAGCAAAGG - Intergenic
1011224204 6:85088993-85089015 CCTATCATCTTCACCACCAATGG + Intergenic
1011271028 6:85580085-85580107 CCTCTCCTCTCCTCAAGCAGAGG - Intronic
1015051828 6:128850287-128850309 CCTCTCGACTACTCCAGCAAAGG + Intergenic
1018417565 6:163614229-163614251 CCTTTCATTTCTCTCAGCAAAGG - Intergenic
1018604204 6:165579722-165579744 CCCCTCATCTCACACAGCGAAGG + Intronic
1019813560 7:3182844-3182866 CCACTCATCTTCCCCAGGATGGG + Intergenic
1019918570 7:4149093-4149115 CCTCTCATCTCCCTGACCCAAGG + Intronic
1020458506 7:8401724-8401746 CCTCTCATCCCCACTAGCATTGG + Intergenic
1022898513 7:34777438-34777460 CCTCTCCCATCCCCCACCAATGG - Intronic
1024849330 7:53692088-53692110 CTTCTCACCTCCCCCTGCCAGGG - Intergenic
1026517675 7:71086907-71086929 CCTCCCTTCTCCGCCAGCCAAGG - Intergenic
1027360154 7:77400088-77400110 ACTCCCATCTCTACCAGCAAAGG + Intronic
1030124114 7:106138531-106138553 CCTCTCATCTCCCTCTCCACAGG - Intergenic
1031794598 7:126156101-126156123 CCTCTCTTGCCCACCAGCAAAGG + Intergenic
1032195994 7:129788901-129788923 CCTCCCACCTCCCCAAGCTAGGG + Intergenic
1032356623 7:131216979-131217001 CCTCTCATTTCCTCAAGCCATGG - Intronic
1033444630 7:141409588-141409610 CATATCATCTCTCCCAGGAAAGG - Intronic
1034365888 7:150547116-150547138 TCTCTTATTTCCTCCAGCAATGG - Intergenic
1034841693 7:154403512-154403534 CCTCTCATCTCCACCTGCTGCGG + Intronic
1034847860 7:154463856-154463878 CCTCTCCTCTCCTCAAGCAGAGG + Intronic
1036460336 8:8947030-8947052 CCTCTCACCTCTCCAAGCCAGGG - Intergenic
1036644077 8:10601293-10601315 CCTCTCACCACCCCCAGCCAGGG - Intergenic
1036706516 8:11050949-11050971 CCTCACATCTCCTCCAGCTATGG + Intronic
1036714650 8:11109551-11109573 CATCTCATCCTCCCCAGGAAAGG + Intronic
1040575442 8:48647454-48647476 CCTCTAACCTCCCCCTGCCAGGG - Intergenic
1041141082 8:54820195-54820217 CCTCTCCTTTCCCCAAGCAGTGG + Intergenic
1041580027 8:59447735-59447757 CCTCTCCAATCCCACAGCAAAGG - Intergenic
1041852296 8:62405158-62405180 CCTCTCCTCTCCTCAAGCAGAGG + Intronic
1042171151 8:65992484-65992506 CCTCTTATGTCCCTCAGTAAAGG - Intergenic
1047059169 8:121203841-121203863 CCTGTCTTCTTCCCCACCAACGG - Intergenic
1049009703 8:139879252-139879274 CCACTCCTCACCCCCAGCCAGGG - Intronic
1049313368 8:141945963-141945985 CCTCTTATCTCCAGCAGCTAAGG + Intergenic
1049696279 8:143985713-143985735 CCTCTCACCTGCCTCAGAAAGGG + Exonic
1050296978 9:4215291-4215313 CCTCTCATCTCTCCCCTCACAGG - Intronic
1050968658 9:11840827-11840849 CCTCTCATTTCCTTCAGCAGTGG - Intergenic
1052170691 9:25392448-25392470 CCTCTCCTCTCCACCACAAATGG + Intergenic
1052717339 9:32132989-32133011 CCTCTCATTTCCTCGAGCAGTGG - Intergenic
1055342197 9:75295937-75295959 CCTCTCCCATCCCCCAGCAGTGG - Intergenic
1055559746 9:77510918-77510940 CATCTCTCCTCCCCCACCAAGGG - Intronic
1056365343 9:85899212-85899234 CCTCACATCTTCACCAGCAGCGG + Intergenic
1057054011 9:91948335-91948357 CCACCCCTCTCCCCCAGCAAAGG + Intronic
1059596885 9:115730534-115730556 CCCTTCTTCTCCCCCAGCAGTGG - Intergenic
1060403456 9:123361400-123361422 CCTTCCAGCTCCCCCAGGAAAGG - Intronic
1061944575 9:133901609-133901631 CCTCTCCTGCCCTCCAGCAAGGG + Intronic
1062266684 9:135689733-135689755 CCTCTCACCTCCCTCACCAAAGG + Intergenic
1188161795 X:26814034-26814056 CCTCTCATTTCCTCAAGCAGAGG + Intergenic
1189029264 X:37433183-37433205 CTTCCCATCTCCCTCAGTAAAGG + Intronic
1189682815 X:43534495-43534517 CCTATCAGCTCCCTCAGCAGAGG + Intergenic
1190122406 X:47672840-47672862 ACTCTCCTCTCCCCAAGCAGAGG + Intergenic
1190537910 X:51447492-51447514 CCACTCCTGTCCCCCAGCAGTGG - Intergenic
1190602767 X:52109192-52109214 CCACTCGTATCCCCCAGCAGTGG - Intergenic
1190808489 X:53861729-53861751 CCTCTCCCATCCCCCAGCAGTGG - Intergenic
1190916695 X:54816536-54816558 CCTCTCACCTCCTCCAGGACTGG - Intergenic
1193554248 X:82933277-82933299 CCTCTCAGCTCCCTGAGCCAGGG + Intergenic
1193563479 X:83048400-83048422 ACTATCCTCTCCCCCAGCAGTGG - Intergenic
1193642600 X:84029322-84029344 CCTCTCCTCTCCTCAAGCAGCGG - Intergenic
1196217633 X:113072263-113072285 CCTCTCCTCTCCTCAAGCAGAGG + Intergenic
1196816023 X:119666211-119666233 CCTCTCCTCTCCCCAACCCAGGG + Intronic
1198757833 X:139999707-139999729 CCTCTCATTTCCTCGAGCAGTGG + Intergenic
1199334379 X:146600977-146600999 CCTCTCCTCTCCTCAAGCAGGGG + Intergenic
1199568844 X:149246854-149246876 CCTCTCCTCTCCTCAAGCAGAGG + Intergenic
1200137844 X:153883569-153883591 CCTGTCCTCTGCCCCTGCAATGG - Intronic
1201074771 Y:10178804-10178826 CCCCACTTCTCCCCCAGCCAAGG + Intergenic