ID: 907424301

View in Genome Browser
Species Human (GRCh38)
Location 1:54369416-54369438
Sequence AAAAGGCATCTTGAAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907424294_907424301 25 Left 907424294 1:54369368-54369390 CCATTGCTGGGGGAGATGAGAGG 0: 1
1: 0
2: 2
3: 33
4: 335
Right 907424301 1:54369416-54369438 AAAAGGCATCTTGAAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907424301 Original CRISPR AAAAGGCATCTTGAAAACCA AGG Intronic
No off target data available for this crispr