ID: 907424398

View in Genome Browser
Species Human (GRCh38)
Location 1:54370168-54370190
Sequence CCAGCCACCAGCTTCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 1, 2: 6, 3: 51, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907424398_907424402 -5 Left 907424398 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG 0: 1
1: 1
2: 6
3: 51
4: 397
Right 907424402 1:54370186-54370208 GCTGGCTGTCAAGCAGGTACAGG 0: 1
1: 0
2: 0
3: 13
4: 117
907424398_907424403 -4 Left 907424398 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG 0: 1
1: 1
2: 6
3: 51
4: 397
Right 907424403 1:54370187-54370209 CTGGCTGTCAAGCAGGTACAGGG 0: 1
1: 0
2: 0
3: 9
4: 135
907424398_907424404 7 Left 907424398 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG 0: 1
1: 1
2: 6
3: 51
4: 397
Right 907424404 1:54370198-54370220 GCAGGTACAGGGCTTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907424398 Original CRISPR CCAGCCACCAGCTTCCAGGA AGG (reversed) Intronic
900003751 1:30293-30315 CAAGCCAACGGATTCCAGGAGGG - Intergenic
900023471 1:200807-200829 CAAGCCAACGGATTCCAGGAGGG - Intergenic
900341837 1:2193339-2193361 GGTGCCACCAGATTCCAGGATGG + Intronic
900427559 1:2587445-2587467 CCAGCCACCAGCTGCGGGGCGGG - Intronic
900630719 1:3633773-3633795 GCAGCCACCATCATCCAGCAAGG + Intronic
900805993 1:4768822-4768844 CCAGCATCCAGGTCCCAGGAAGG + Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
901347896 1:8563464-8563486 CCTGCCACCAGCTCACAGCAGGG + Intronic
901679035 1:10902550-10902572 GCAGCCAGTAGCTTCCATGAAGG + Intergenic
901765428 1:11496909-11496931 CCAGCCACCAGCTTTCTGGGTGG - Intronic
901816847 1:11799239-11799261 CCAGCCTTCAGCTTCAAGGGTGG + Intronic
902684138 1:18064871-18064893 CCAGCCACCTGCAGCCAGGGTGG - Intergenic
902705352 1:18200467-18200489 GCAGCCACCAGCAGCTAGGAAGG - Intronic
902788592 1:18749620-18749642 CCAGCCCCCAGCCTCAAGGTGGG - Intergenic
903181480 1:21607118-21607140 CCATCCTCCAGCTTCCCGGCCGG - Intronic
903248000 1:22030598-22030620 TCAGCCACCACCGTCCAGCAAGG - Intergenic
903457186 1:23495858-23495880 CCAGCCACCAGGTTCCTTGGAGG - Intergenic
903479879 1:23645310-23645332 TCAGCCCCCAGCTTCCCAGAGGG - Intergenic
904118450 1:28179208-28179230 CCAGCCACCACCCTCCAGGAGGG + Intronic
906071839 1:43022408-43022430 TCAGCTACCAGCTTCCTGGAAGG - Intergenic
907424398 1:54370168-54370190 CCAGCCACCAGCTTCCAGGAAGG - Intronic
908535544 1:65073191-65073213 CCAGCCAGCAGCTGGGAGGAAGG - Intergenic
908729243 1:67208818-67208840 CCATCCTCCAGATTCCAGAATGG + Intronic
908831780 1:68185918-68185940 CCACCCACCAACAGCCAGGAGGG - Intronic
909123862 1:71640131-71640153 CCAGCCAACAGTTTCCGGTATGG + Intronic
909548187 1:76869340-76869362 CCATGCAGCAGCTTCCCGGAAGG - Intronic
910043464 1:82883289-82883311 CCAGTCACCATGTTTCAGGATGG - Intergenic
911121583 1:94302236-94302258 CCCATCACCATCTTCCAGGAGGG + Intergenic
912836373 1:112999998-113000020 CCAGCCCCCAGCTTCCAGGGAGG - Intergenic
913329866 1:117658572-117658594 ACATCCAGCAGGTTCCAGGAAGG + Intergenic
914428475 1:147599817-147599839 CCCGCCCCCAGCTTCCCGCAGGG - Intronic
916039626 1:160950970-160950992 CTGGCCACCAGCCTGCAGGAGGG - Intronic
916909890 1:169335848-169335870 CAAGCCAGCTGCTTCCAGTAAGG + Intronic
917130663 1:171739196-171739218 CCACCCCCTAGCTTCCTGGAAGG + Intronic
917968858 1:180194797-180194819 CCAGGCACCGGCTCCCAGGAGGG + Intronic
918082403 1:181217778-181217800 CCAGCCCCTCTCTTCCAGGAAGG - Intergenic
918276782 1:182960196-182960218 CGCTCCACCAGCTTCCAGGGCGG - Intergenic
922727769 1:227931814-227931836 CCAGTCAGCAGCTACCAGCATGG - Intronic
923086223 1:230705452-230705474 CCAGCCGCCAGCCGCCAGCAAGG + Intronic
923146170 1:231199834-231199856 TCAGCCACCAGCTTCTTGGCTGG - Intronic
923349889 1:233093693-233093715 CCAGCCTCCAGCCTCCAGGGAGG + Intronic
924732354 1:246724045-246724067 GCCGCCTCCAGCTTCCAGCAGGG + Exonic
1062792572 10:318304-318326 CCACACCCTAGCTTCCAGGAAGG - Intronic
1062975381 10:1678843-1678865 CCAGGCAGCAGGGTCCAGGAGGG - Intronic
1063415442 10:5869409-5869431 CCAGCCACCTGTGTCCAGCAAGG + Intronic
1064097215 10:12432851-12432873 CCACCCACCTGCTCCCAAGATGG + Intronic
1065166675 10:22986131-22986153 CCAACCACTAGCATCCATGAAGG + Intronic
1065793261 10:29281255-29281277 CCATCCACCTGCCTCCAGGCTGG + Intergenic
1067229063 10:44394397-44394419 CCAGCCAGCACCTTCCTGGGGGG + Intergenic
1067495084 10:46754399-46754421 TACCCCACCAGCTTCCAGGAGGG + Intergenic
1067599571 10:47585997-47586019 TACCCCACCAGCTTCCAGGAGGG - Intergenic
1068227067 10:54118937-54118959 CCAGCAAACAGCTCCCACGATGG + Intronic
1069591778 10:69646384-69646406 CCAGCCCCCAGCCCCCAGCACGG - Intergenic
1070107318 10:73446679-73446701 CCTGCCACCAGCTTACATGGAGG + Intronic
1071376339 10:85008986-85009008 TCAGCTTCCTGCTTCCAGGAGGG - Intergenic
1071651101 10:87393881-87393903 TACCCCACCAGCTTCCAGGAGGG - Intergenic
1072195440 10:93113901-93113923 CAAGCCACCATCTTCTTGGATGG - Intergenic
1072521494 10:96233709-96233731 GGTGCCACCAGCTTCCAAGAGGG - Intronic
1072706141 10:97682380-97682402 ACAGCAACCAGCTTCCAAAAGGG + Intronic
1073467790 10:103704406-103704428 CCAGCCACCAGCCACCAGTGTGG - Intronic
1074021382 10:109587979-109588001 CCATCCACCTCATTCCAGGAAGG - Intergenic
1075126308 10:119702655-119702677 ACAGTTACCAGCTTCAAGGATGG + Intergenic
1075623172 10:123942697-123942719 CCAGCCAGCAGCCCTCAGGAGGG + Intergenic
1076055149 10:127366743-127366765 CCATCCACGAGCTTCTGGGATGG + Intronic
1076165164 10:128275986-128276008 CCGCTCATCAGCTTCCAGGAGGG - Intergenic
1076285928 10:129296499-129296521 CCAGCCACCACCTTCCCCCAGGG - Intergenic
1077386605 11:2272172-2272194 CCAGCCAGCAGCATCCTGCAGGG - Intergenic
1077456386 11:2683803-2683825 CCAGCCACTAGCTTGCAGAATGG + Intronic
1077463460 11:2722367-2722389 CCAGCACTCAGCTCCCAGGATGG - Intronic
1078745814 11:14113299-14113321 CCAGCCACCAGCTACCACAATGG + Intronic
1079135537 11:17774287-17774309 CCAGGCCCCAGCTTCCATGTGGG + Intronic
1080777777 11:35402253-35402275 CCACCCACCAAATTCCAGGGAGG + Intronic
1080827639 11:35861365-35861387 CGCTCCACCAGCTTCCAGGGTGG - Intergenic
1081291137 11:41327305-41327327 GCAGCCAGCAGCTTCCTGGTGGG + Intronic
1081632721 11:44700766-44700788 CCTGCCTCTGGCTTCCAGGAAGG - Intergenic
1081831769 11:46120957-46120979 CCTGCCTCCAGCTGCCAGGGGGG - Exonic
1082091834 11:48096652-48096674 ACAGCCACAAGCCCCCAGGAAGG - Intronic
1082210757 11:49498483-49498505 ACAGCCACCATCCTACAGGAGGG + Intergenic
1083110545 11:60401934-60401956 CAAGCCACAAACTTCCAGAAAGG + Intronic
1084105269 11:66976607-66976629 CCAGCTGTCAACTTCCAGGACGG + Exonic
1084172714 11:67408391-67408413 CAAGCCACCAGCTTCCTGCCAGG - Intronic
1084203821 11:67579401-67579423 ACAGCCTGCAGCCTCCAGGAGGG - Intergenic
1084857628 11:71999120-71999142 CCAGCCACCAGCCCCAAGGTCGG - Exonic
1085304453 11:75477224-75477246 CCAGCTCCCAGGCTCCAGGATGG + Intronic
1085442999 11:76580076-76580098 CCACCCACCAGCCTCCAGGTGGG - Intergenic
1086083670 11:82932539-82932561 ACAGCCAGCAGTTCCCAGGATGG + Exonic
1086638882 11:89126306-89126328 ACAGCCACCATCCTACAGGAGGG - Intergenic
1086949949 11:92881955-92881977 GCAGCCCCCAGCTTCCCAGAGGG + Intronic
1089113204 11:116073058-116073080 ACAGCCACCAGCCTGCAGGCTGG - Intergenic
1089279735 11:117365431-117365453 CCATCCACCAGCTGACAGCAGGG - Intronic
1089376079 11:117995750-117995772 CCACACCCGAGCTTCCAGGAGGG + Intronic
1091377170 12:32345-32367 CAAGCCAACGGATTCCAGGAGGG - Intergenic
1091568228 12:1662864-1662886 TCACCCACCAGCTGCAAGGACGG + Intergenic
1091640327 12:2231110-2231132 CCAGTCACCAGCTGCCTGGCAGG - Intronic
1091651419 12:2313143-2313165 CCAGCCACCACCATCCAGCTTGG + Intronic
1091744744 12:2983911-2983933 CCAGCCCCCATCTCCCAGTAAGG - Intronic
1092147966 12:6227876-6227898 CCAGCCAGCAGCTGACAGGTGGG + Intronic
1092295158 12:7191214-7191236 TCAGCCACCAACTGCCAGAAGGG - Exonic
1093519573 12:20032814-20032836 TGAGCCACCACCATCCAGGAGGG + Intergenic
1095779885 12:46048089-46048111 CCAGCAAACAGCTTCCATGATGG + Intergenic
1096400181 12:51299531-51299553 CCAGCCACCTGCTACCACCATGG + Intronic
1097141077 12:56902923-56902945 CCAGTCACCAGGTCCAAGGATGG + Intergenic
1097158514 12:57029460-57029482 TCAGTCACCAGCCTCAAGGATGG - Exonic
1101875045 12:108592127-108592149 CCCCCCACCAACTTCCTGGATGG - Exonic
1101946723 12:109142985-109143007 CCAGCAAACAGCTGGCAGGAGGG + Intronic
1103253256 12:119519220-119519242 CCAGCCCCCAGCCTCAAGGCCGG + Intronic
1103459123 12:121089820-121089842 CCTCTCGCCAGCTTCCAGGATGG + Intergenic
1103959488 12:124600045-124600067 CCAGGCCCCAGCTGCCAGGAGGG - Intergenic
1104202126 12:126599823-126599845 ACAGCCACCAGCTTGCAAGATGG + Intergenic
1104587999 12:130062884-130062906 CCATCCTCCAGATTCCAGAATGG + Intergenic
1104836607 12:131795944-131795966 CCAGGCACCAGCAAGCAGGACGG + Intronic
1105826835 13:24130222-24130244 CCAGCCCCTGGCTTCCAGGGTGG - Intronic
1107554536 13:41506133-41506155 CCATTCTCCTGCTTCCAGGAAGG + Intergenic
1108233086 13:48370811-48370833 CCAGCCCCCAACCTCTAGGAAGG - Intronic
1108651053 13:52480150-52480172 CAAGCCACTACATTCCAGGATGG - Intergenic
1113088697 13:106594744-106594766 CCAGTCCCCAGCCTCCAGGCCGG - Intergenic
1114063619 14:19040973-19040995 CAAGCCACCATCTTCAAGGGAGG - Intergenic
1114098637 14:19359023-19359045 CAAGCCACCATCTTCAAGGGAGG + Intergenic
1115574003 14:34693485-34693507 CCAGGCACCAGCATGCAGGCTGG + Intergenic
1117490509 14:56242039-56242061 CTAGCAATCAGCTTCCAGGTAGG + Intronic
1117512888 14:56471229-56471251 CCAGTCACCAGGTCCCCGGATGG + Intergenic
1118763693 14:68895976-68895998 TCAGCCACCTGCTCCCAGGATGG + Intronic
1119216311 14:72871817-72871839 CCATCCTCCAGATTCCAGAATGG - Intronic
1119572521 14:75688213-75688235 CCACCCCTCAGCCTCCAGGAAGG + Intronic
1121169680 14:91843110-91843132 CCAGCCAGCTGCTCCAAGGAGGG + Intronic
1121242153 14:92438851-92438873 CCAGCCCCCAACCTCCAGGGAGG - Intronic
1121643384 14:95501161-95501183 CCTGCCAGCAGCTTGCAGGCTGG - Intergenic
1122346945 14:101066643-101066665 CCACCCACCCGCCTCCAGGATGG - Intergenic
1122807451 14:104267158-104267180 GCAGCCACCAGCCCCCAGCAGGG - Intergenic
1122852673 14:104545474-104545496 CCATCCCCCAGGTTGCAGGAGGG + Intronic
1123007942 14:105333430-105333452 CCAGGGACTGGCTTCCAGGAGGG - Intronic
1123492924 15:20797200-20797222 CAAGCCACCATCTTCAAGGGAGG + Intergenic
1123549425 15:21366302-21366324 CAAGCCACCATCTTCAAGGGAGG + Intergenic
1124252399 15:28115460-28115482 CCAGCCAGCTGCTTCCAGACAGG + Exonic
1125394032 15:39227287-39227309 CCACCCACCATCCTCCATGAAGG - Intergenic
1125608915 15:40957900-40957922 CCCACCATCAGCTCCCAGGATGG - Intergenic
1126517031 15:49550075-49550097 CCAGCCGCCCCCGTCCAGGAGGG - Intronic
1127801030 15:62477744-62477766 CCAGTCCCCAGCTTCCAGTATGG - Intronic
1129261985 15:74373860-74373882 CCAGCCGCCCGCGTGCAGGAAGG + Intergenic
1129335199 15:74847926-74847948 GCATCCATCAGCTTTCAGGAGGG + Intronic
1130901096 15:88207238-88207260 CCAGGCACCTGCCTCCAGGATGG + Intronic
1132056533 15:98654888-98654910 CCAAACACCATTTTCCAGGAGGG - Intronic
1132354720 15:101162876-101162898 TCAGCCAACACCTGCCAGGAGGG + Intergenic
1132449751 15:101960647-101960669 CAAGCCAACGGATTCCAGGAGGG + Intergenic
1202957756 15_KI270727v1_random:93520-93542 CAAGCCACCATCTTCAAGGGAGG + Intergenic
1132614822 16:835313-835335 CAAGCCATGAGCCTCCAGGAGGG + Intergenic
1132807403 16:1781542-1781564 CCAGCCCTGAGCTTCCAGGCTGG + Intronic
1133049464 16:3108863-3108885 CCAGCCACCAGCTTACATACGGG - Intergenic
1133107330 16:3520990-3521012 CCAGCCACCAACATCCAAAAAGG - Intronic
1133322591 16:4923480-4923502 CCAGCCATCAGCGACCTGGAAGG + Intronic
1133384295 16:5356208-5356230 GCAGCCACCAGGAGCCAGGAGGG + Intergenic
1137878976 16:52026599-52026621 GCATCCACCAGCTTGCAGGCAGG - Intronic
1138638595 16:58364295-58364317 CCTGCCACCAGCATCCATGCAGG - Intronic
1139325049 16:66146029-66146051 CCAGCCATCCCCTTCCAAGAGGG - Intergenic
1139873577 16:70127249-70127271 CCAGCAGCCAGCCTGCAGGATGG - Exonic
1139914036 16:70417359-70417381 GCAGGCACCGGCCTCCAGGAAGG + Intronic
1139939933 16:70597957-70597979 CCAGCTACCAGCTACTTGGAGGG - Intronic
1140266855 16:73428508-73428530 CCAGCCACCAGCCACCAGCGAGG + Intergenic
1140362201 16:74353899-74353921 CCAGCAGCCAGCCTGCAGGATGG + Intergenic
1140745114 16:77974330-77974352 AAAGCCATAAGCTTCCAGGATGG - Intronic
1140887728 16:79259330-79259352 CCAGCCACCACTCTGCAGGATGG + Intergenic
1141310217 16:82906767-82906789 GGAGCCACCAGCATCTAGGAAGG - Intronic
1141557738 16:84846930-84846952 CCAGCCGTCAGCCCCCAGGAGGG - Intronic
1141624355 16:85253512-85253534 CCAGAAACCAGCCTACAGGAGGG - Intergenic
1141862592 16:86728183-86728205 GCAGCTACCAGCATCCAGGCAGG + Intergenic
1142070630 16:88089833-88089855 CAAGCCGCCAGCATCCCGGAAGG + Intronic
1142145171 16:88489911-88489933 TCACCCACCAGCTCCCATGACGG - Intronic
1142157490 16:88539266-88539288 CCACCCTCCTTCTTCCAGGAGGG + Intergenic
1142187324 16:88700829-88700851 GCACCCTCCAGCTGCCAGGAGGG - Intronic
1142903875 17:3029671-3029693 CCAGCCAGCAGCTTCCAGGAAGG + Intronic
1143135886 17:4711991-4712013 CCAGCCACCTCCTGCCAGGCTGG - Intronic
1143416706 17:6755979-6756001 CCAGCCCACAGCTTCAGGGAGGG - Exonic
1144081368 17:11767074-11767096 TCAAGCACCAGCTTACAGGAAGG + Intronic
1144776779 17:17788789-17788811 CCAGCCACCACCTCCCAGCTGGG + Intronic
1144952616 17:19002352-19002374 CCTGGCCCCAGTTTCCAGGAAGG - Intronic
1147536714 17:41326572-41326594 CCAGCCACCAGCCTCCAGCCTGG + Intergenic
1147767621 17:42847327-42847349 TCAGGCACCAGCTCACAGGATGG + Intronic
1148581989 17:48750522-48750544 CTTGCCAGCAGCTTCCAAGATGG + Intergenic
1148983718 17:51602126-51602148 CCACCCACCAACTTTCAGGAAGG + Intergenic
1150209433 17:63434057-63434079 CCAGGCATCTGCTGCCAGGAGGG + Exonic
1151006523 17:70443778-70443800 CCAGGGACCAGTTTCCTGGAAGG - Intergenic
1151433940 17:74082582-74082604 AGATCCACCAGCTTCCACGATGG - Intergenic
1203172633 17_GL000205v2_random:163185-163207 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1203173091 17_GL000205v2_random:169595-169617 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1154021913 18:10670787-10670809 CCAGTGACCAGCTTCAATGAGGG - Intronic
1154450466 18:14471737-14471759 CAAGCCACCATCTTCAAGGGAGG + Intergenic
1155956734 18:31960986-31961008 CCAGCCGCCCCCTTCCGGGAGGG + Intergenic
1157259584 18:46166638-46166660 CCACCCACAACCTCCCAGGATGG - Intergenic
1157801871 18:50627426-50627448 CCAACCACCAGCTTCAGGGGTGG + Intronic
1159798821 18:72871475-72871497 CAAAGCACCATCTTCCAGGATGG - Intergenic
1160635504 19:71900-71922 CAAGCCAACGGATTCCAGGAGGG - Intergenic
1160662327 19:306848-306870 CCAGCCACCAGCTCCCCTCAGGG - Intronic
1160975908 19:1792256-1792278 CCAGCCAACAGCAGCCAGAAGGG + Intronic
1161752113 19:6105655-6105677 CCAGCCACCAGCATCTAGCCCGG - Intronic
1162478607 19:10915376-10915398 CCAGCAGCCAGCTTGCAGGGAGG + Intronic
1164248867 19:23459365-23459387 CCTGCATCCAGCTTTCAGGAGGG + Intergenic
1164303155 19:23979830-23979852 CCTGCACCCAGCTTTCAGGAGGG - Intergenic
1164596606 19:29534311-29534333 CCTGCCTTCAGGTTCCAGGAGGG - Intronic
1164684559 19:30158260-30158282 CCAGGCAGCAGCTCCCAGCATGG + Intergenic
1165430280 19:35768078-35768100 CCTGCCTCCAACATCCAGGAGGG - Intronic
1165466787 19:35979342-35979364 CCAGCCATCAGCTCACAGGCAGG - Intergenic
1165777451 19:38413151-38413173 CCGGCCGCCAGCAGCCAGGAGGG - Intronic
1166142816 19:40814192-40814214 TCAGTCACCAGGTTCCAGAAAGG - Intronic
1166184741 19:41132610-41132632 TCAGTCACCAGGTTCCAGAAAGG + Intergenic
1167861140 19:52285000-52285022 CCAACCACCATCCTCCAGGAAGG - Intronic
1168646775 19:58064194-58064216 CCTGTCACCAGAGTCCAGGAGGG + Intronic
925381082 2:3426703-3426725 CCACCGAGCAGCTTCCAGGCTGG - Intronic
925808088 2:7672240-7672262 GCAGCCACCAGGTGGCAGGATGG - Intergenic
926006558 2:9377570-9377592 CCAGCCTTCAGCTGCCAGGCAGG - Intronic
926148517 2:10411629-10411651 CCAGTCACCAGCTCCCTGGGGGG - Intronic
926615719 2:14994927-14994949 CCAGCCATGGGCTTCAAGGATGG - Intergenic
927431329 2:23028521-23028543 CCAGTCACCAGCTTGCAGGAAGG + Intergenic
929866025 2:45717968-45717990 CCAGCCACCAGCTTCTTGAGGGG - Intronic
930079196 2:47433280-47433302 CCCCCCACCTGCCTCCAGGACGG + Intronic
933787846 2:85858189-85858211 CCAGCCTCCATCTTCCAGTCAGG + Intronic
934733273 2:96672834-96672856 CCAGCCACCTGATTTCAGGAAGG + Intergenic
934912534 2:98272554-98272576 CCAACCCCCAACCTCCAGGAGGG - Intronic
935241837 2:101185605-101185627 ACAGACCCCAGCTTCCAGAATGG + Intronic
936475777 2:112838508-112838530 CCAGACACCAAATTTCAGGAGGG - Intergenic
937210612 2:120267117-120267139 GCAGCCTCCTGCTTACAGGAAGG + Intronic
937241502 2:120465264-120465286 CCAGCCACCATCCTCTAGGCAGG - Intergenic
937831978 2:126434182-126434204 GAATCCACGAGCTTCCAGGAAGG - Intergenic
938074293 2:128323503-128323525 CCGGCCATCATCCTCCAGGAAGG - Intergenic
938480945 2:131660996-131661018 CAAGCCACCATCTTCAAGGGAGG - Intergenic
939367490 2:141251980-141252002 TCTCCCACCAGTTTCCAGGAGGG + Intronic
940299278 2:152160808-152160830 CCCCCCACCACCTTCCCGGACGG - Intronic
942102226 2:172595562-172595584 CAGTCCAGCAGCTTCCAGGATGG + Intronic
942985442 2:182135250-182135272 CAAGCCTGCATCTTCCAGGATGG + Intergenic
943372141 2:187028532-187028554 CCATCCTCCAGATTCCAGAATGG + Intergenic
944855801 2:203765441-203765463 CGCTCCACCAGCTTCCAGGGTGG - Intergenic
946225486 2:218262048-218262070 CCTCCCTCCAGCTCCCAGGAAGG + Exonic
946242766 2:218367161-218367183 CCAGCCCCCTGCATCCTGGAAGG - Intronic
947429255 2:230011297-230011319 TCAGCCACCAGCTTCATGGCTGG - Exonic
947760489 2:232600309-232600331 CCAGACCGCAGCTGCCAGGATGG + Intergenic
947883753 2:233545523-233545545 CATGCCACCAGCTTCCTGGGGGG - Intronic
948121317 2:235532820-235532842 CCATGCACCGGCTGCCAGGAGGG - Intronic
948132754 2:235612768-235612790 CCTGGCACCTGCTTCCAGGTTGG + Intronic
948266373 2:236638030-236638052 CCAGCCAAAAGCTTTGAGGAGGG - Intergenic
948574413 2:238940567-238940589 CCAGCCAACAGCTTCCAGGCAGG + Intergenic
948763530 2:240207915-240207937 CAAGCCTCCTGCCTCCAGGAGGG - Intergenic
948804063 2:240445573-240445595 CCAAACACCAGCATGCAGGAGGG + Intronic
1168856619 20:1013452-1013474 TCAGCCACCTCCTTCCTGGAGGG + Intergenic
1169390390 20:5185981-5186003 CCATCCACCAGCTTTCAGGCAGG + Intronic
1170710555 20:18786880-18786902 CCATCCTCCAGATTCCAGAATGG - Intergenic
1171010038 20:21504541-21504563 CCAGCCCCCACCAACCAGGATGG + Intergenic
1171011552 20:21512053-21512075 GCAGCCGCCACCTTCCAGGCGGG - Exonic
1171465037 20:25321402-25321424 CCTCCCACCAGCTTCCTGAAAGG - Intronic
1172852186 20:37974457-37974479 GCAGCCTTCAGCTTCTAGGAAGG - Intergenic
1173199934 20:40946928-40946950 TCAGCCACAGGCTTCCAGGTGGG + Intergenic
1173262537 20:41449563-41449585 TCAGACACCAGCTTGGAGGAGGG - Intronic
1173294731 20:41747028-41747050 CCAGCCACCCTCATCAAGGAAGG - Intergenic
1173521589 20:43704041-43704063 CCAGCCTCCAGCCTCCAGCCTGG - Intronic
1173527917 20:43746998-43747020 CCAGCTCCCAGCTTCCTGGAAGG + Intergenic
1173925867 20:46780766-46780788 CCAGGCACCATCTCTCAGGAGGG + Intergenic
1174451750 20:50624886-50624908 CCTGCCCCCAGCCTCCAGGCGGG + Intronic
1174610429 20:51793756-51793778 CCACCCACGGGTTTCCAGGAGGG + Intronic
1175013566 20:55764569-55764591 CCATCCTCCAGCTCCCAGAATGG - Intergenic
1175152793 20:56948300-56948322 CCAGACACCACCTTCCATCAGGG - Intergenic
1175171088 20:57082033-57082055 TCTGCCAGCAGCTGCCAGGAGGG + Intergenic
1175502369 20:59459766-59459788 TCAACCACCAGATCCCAGGAAGG + Intergenic
1175877026 20:62235221-62235243 CCAGCCAGCAGCTGCCAGCCAGG + Intronic
1175897801 20:62347059-62347081 CCTGCCACCTGCCTCCAGGATGG - Intronic
1175919651 20:62444752-62444774 CCAGCCACCAGTCCCCAGGCTGG + Intergenic
1175995344 20:62809776-62809798 GTGGACACCAGCTTCCAGGAAGG - Intronic
1176328627 21:5524973-5524995 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1176329074 21:5531237-5531259 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1176398683 21:6289714-6289736 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1176399130 21:6295978-6296000 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1176438027 21:6693126-6693148 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1176438474 21:6699390-6699412 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1176445727 21:6818646-6818668 CAAGCCACCATCTTCAAGGGAGG - Intergenic
1176462289 21:7020196-7020218 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1176462736 21:7026460-7026482 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1176485850 21:7401974-7401996 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1176486297 21:7408238-7408260 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1176823894 21:13683679-13683701 CAAGCCACCATCTTCAAGGGAGG - Intergenic
1178676948 21:34639099-34639121 CCAGCCAGCAGGTTCCAACAGGG - Intergenic
1178709247 21:34899770-34899792 GCAGCCAGCAGCTTGCAAGATGG + Intronic
1178885228 21:36479634-36479656 CCAACCAGACGCTTCCAGGACGG + Exonic
1179889313 21:44327636-44327658 CCAGCCACCAGCCTGCAGGTTGG - Intergenic
1180163539 21:46008668-46008690 GCGGCCACCAGCTTGGAGGATGG - Intergenic
1180482114 22:15763607-15763629 CAAGCCACCATCTTCAAGGGAGG - Intergenic
1180736787 22:18023619-18023641 CCCGCCCTCTGCTTCCAGGAGGG + Intronic
1181613852 22:24038193-24038215 CCACCTCCCAACTTCCAGGAAGG - Intronic
1182298854 22:29327040-29327062 CCAGCTTCCAGCAGCCAGGAAGG + Intergenic
1183623774 22:38989620-38989642 CCAGCCACCTGCATCCAGGCAGG + Intronic
1183639387 22:39083894-39083916 CCAGCCACCCGCATCCAGGCAGG + Intronic
1183719277 22:39552958-39552980 CCAGCCACTACCTTCCAGACTGG + Intergenic
1183831319 22:40419650-40419672 CCAGCCCCCAGCCCCCAGCATGG + Intronic
1184343215 22:43897564-43897586 TCAGCCACCAGCTAACAGGAGGG + Intergenic
1184387707 22:44185824-44185846 CCTGCCACCCACTTCCCGGAAGG + Exonic
1184482366 22:44755301-44755323 CCAGACACCAGCTCCCATGTGGG - Intronic
1184681786 22:46076094-46076116 CCAGCCACCAGCGTCCTCGCTGG + Intronic
1184694838 22:46133489-46133511 CCAGCCCACAGCTCCAAGGAGGG + Intergenic
1184935272 22:47716357-47716379 CCTGCCACCAGGGGCCAGGAGGG + Intergenic
1185105078 22:48864163-48864185 CCAGCAATCGGCTTCCAGGAGGG + Intergenic
1185242487 22:49754188-49754210 CCAGGCACCTGCTGCCAGGTGGG - Intergenic
1185347335 22:50316362-50316384 CCACTCACCTGCTTCCAGGCAGG + Exonic
949109861 3:246461-246483 TCAGCCATCAGGTTCCAGGAAGG + Intronic
949581683 3:5394805-5394827 CCAGCCACCCTCTTAAAGGAAGG - Intergenic
950425190 3:12921283-12921305 GCACCCACCTCCTTCCAGGACGG - Intronic
950470914 3:13185839-13185861 CCAGCCAGTGGCATCCAGGATGG - Intergenic
952575857 3:34773457-34773479 CCATCCTCCAGATTCCAGAATGG + Intergenic
954703546 3:52465784-52465806 CCAGCCTCCAGCTCACAGGCAGG - Intronic
955101136 3:55851193-55851215 CCTGCCACCAACTCCCAGCATGG - Intronic
956287252 3:67623811-67623833 CAAAACACCAGCTTCCAGGGTGG + Intronic
956786598 3:72647975-72647997 CAAGCCACTAGGTTTCAGGATGG + Intergenic
958646539 3:96882083-96882105 CCATCCTCCAGATTCCAGAATGG - Intronic
959228368 3:103615961-103615983 CCACCCTCCAACATCCAGGAAGG + Intergenic
959297584 3:104556882-104556904 CCAGCCACCAGCCAGCAAGAAGG - Intergenic
960050025 3:113230328-113230350 CTAGCCACCATGTTTCAGGATGG - Intronic
961378953 3:126484779-126484801 CCTCCCACCAGCCTCCAGGTGGG + Intronic
961470364 3:127107564-127107586 GCAGCCTCCACCTTCCAGGAGGG + Intergenic
962191393 3:133314704-133314726 CCATCCACCAATTACCAGGATGG - Intronic
962423356 3:135247951-135247973 AGTGCCACCAGCTTCCAGTAAGG + Intronic
962712558 3:138100155-138100177 CCACCCTCCAGCCTCCAGGGAGG + Intronic
964094255 3:152913067-152913089 ACATCCACCAGCTTCCAGAAAGG - Intergenic
964704489 3:159603403-159603425 CCCGCCACCAACCTCCAGGTAGG - Intronic
964725859 3:159814021-159814043 CCCTCCACCCGCTTCCAGGAGGG + Intronic
964995564 3:162874811-162874833 CCAGAGACCAGTTTCCTGGAAGG - Intergenic
966382329 3:179356240-179356262 CCACCCACCCATTTCCAGGAAGG + Intronic
966692046 3:182751960-182751982 GCAGCAGCCAGCTTCCAAGATGG + Intergenic
966876642 3:184325863-184325885 CCAGCCACCATCATCCACAAGGG - Exonic
967214792 3:187200800-187200822 CCAACCACCATCTTTCAGGCAGG - Exonic
967469850 3:189848962-189848984 CCACCCCCCAGCCTCCAGGAAGG + Intronic
968398012 4:261418-261440 AAAGCCACAATCTTCCAGGAAGG + Intergenic
968593586 4:1471600-1471622 TCAGCCACCTGGTTCCAGAAGGG - Intergenic
968598226 4:1496209-1496231 CCAGCCTCCAGCACCCAGGCTGG - Intergenic
969845468 4:9916951-9916973 GCAGCCTCCATCTCCCAGGATGG + Intronic
969866455 4:10079694-10079716 CAAGCCACCAGCTGTCATGAGGG + Intronic
969966995 4:11007126-11007148 TCAGCCACCACCTCCCAGGCAGG - Intergenic
970007831 4:11427960-11427982 CTAGACCCCAGCTCCCAGGAAGG - Intronic
970793607 4:19888464-19888486 CCAGCCACCATCTTCCCAGCTGG + Intergenic
971422719 4:26488863-26488885 ACAGTCAACAGCTTCCAGAAAGG + Intronic
974682753 4:65184435-65184457 GCAGGTACCAGCTACCAGGAAGG + Intergenic
974950177 4:68577475-68577497 CCAGCCACCATCTTCCCAGCCGG + Intronic
979120477 4:116893421-116893443 CAAGGCAGCACCTTCCAGGATGG - Intergenic
980210583 4:129782111-129782133 CCCACCCCCATCTTCCAGGAAGG - Intergenic
980892649 4:138831673-138831695 CCAGCCTCCAGCCTCCAGCCTGG - Intergenic
983497627 4:168461109-168461131 CCAGCCACCAACCTCTGGGAAGG - Intronic
983908148 4:173206015-173206037 CCAGGTTCCAGGTTCCAGGATGG - Intronic
985587100 5:746137-746159 TCAGCCACGAGCTTCCATGGAGG + Intronic
985601671 5:838320-838342 TCAGCCACGAGCTTCCATGGAGG + Intronic
986622753 5:9692555-9692577 CCTGCCATCTGCTTCCAGTAAGG + Intronic
986772672 5:10988068-10988090 CAAGCCACCAAGTTCCAGGAGGG + Intronic
987246518 5:16054528-16054550 CCAGCTACCACCTTCAATGAGGG + Intergenic
989147208 5:38260706-38260728 CCAGACACTAGCTTTCAGGTTGG + Intronic
989818363 5:45764393-45764415 CCAGCCACCTTCTTCAAGGCTGG - Intergenic
990530606 5:56669798-56669820 CCAGCCAACAGCTGGCAGGCAGG + Intergenic
991523942 5:67534781-67534803 CCAGTTACAAGCTTCCAGGAAGG + Intergenic
992415772 5:76550997-76551019 CCAGCCACCCCCGTCCGGGAGGG - Intronic
992493747 5:77271344-77271366 CCAGCCACAGCCTTCCAGGGTGG - Intronic
992493900 5:77272606-77272628 CCAGCCACAGCCTTCCAGGGTGG - Intronic
992742783 5:79790787-79790809 CCAGCCACCGGCATCCACGAAGG + Intronic
992773504 5:80070244-80070266 TCAGCCACCAGCTTCCTGCCAGG + Intronic
993026840 5:82656837-82656859 CCAGTCCCCACCTGCCAGGATGG - Intergenic
994353372 5:98770302-98770324 CCAGCCACTCGCTCCCAAGAAGG - Intronic
994484918 5:100379442-100379464 GTAGCCAGCAGATTCCAGGAAGG + Intergenic
995301554 5:110590592-110590614 CCAGAGACCAGTTTCCTGGAAGG - Intronic
996451983 5:123636257-123636279 CGCTCCACCAGCTTCCAGGGCGG + Intergenic
996746176 5:126848053-126848075 CCAACCAGCAGATGCCAGGAAGG + Intergenic
997123144 5:131196786-131196808 GCAGGCACCAGCTACCAGGGAGG - Intronic
998377676 5:141702064-141702086 CCAGCCCCCAGCCTACAAGAGGG + Intergenic
999712242 5:154328958-154328980 CAACCCACCATCCTCCAGGAAGG - Intronic
1001080724 5:168665412-168665434 CCAGCCTTCCGCTTCCAAGAAGG + Intronic
1001978585 5:176021467-176021489 CCAGGCACCACCTCCCTGGAGGG - Intronic
1002238832 5:177822295-177822317 CCAGGCACCACCTCCCTGGAGGG + Intergenic
1002758587 6:184207-184229 CCACCCTGCAGCTTCCAGGTGGG + Intergenic
1003341317 6:5223988-5224010 CCACCTAGCAGCTTCCAGCAAGG + Intronic
1004871990 6:19914536-19914558 CCAGCAAGCAGCTCCCATGATGG + Intergenic
1005980461 6:30832358-30832380 CCACCTCCCAGCCTCCAGGAAGG - Intergenic
1005999784 6:30955860-30955882 CCAGCCCCCAGCCCCCAGGGAGG + Intergenic
1006385022 6:33726120-33726142 CCAGCCACCCATTTGCAGGAAGG + Intronic
1007252069 6:40502512-40502534 CCTGCTGCCAGCTTCCAGCATGG - Intronic
1007351059 6:41273816-41273838 CCTGCCACCACCTGCCAGGGAGG + Intronic
1007586082 6:42990348-42990370 CCAAACACCAGTTTCCAGGTAGG - Intronic
1007937922 6:45750387-45750409 CCACCCACCAGCCTCTGGGAAGG + Intergenic
1008154559 6:47997757-47997779 TAAGCCACCATGTTCCAGGAAGG + Intronic
1009832998 6:68963129-68963151 CCTGCCACCAGCTTCCAGTAAGG + Intronic
1010908492 6:81522870-81522892 CCAGCCCCCAACATCCAGGGAGG + Intronic
1014968878 6:127790841-127790863 CCAGGCACCAGCTCCCTGCAAGG + Intronic
1015634589 6:135263237-135263259 CCGGCACCCAGCTTCCAGAATGG - Intergenic
1015645644 6:135385156-135385178 CCAGCCTCTAGCTACCATGATGG + Intronic
1016773136 6:147874521-147874543 CCTGCCACCAGCTGGCCGGAGGG - Intergenic
1017124255 6:151051017-151051039 CCACCCATCAACCTCCAGGAAGG - Intronic
1017891325 6:158642193-158642215 CTAACCACCAGCTGCCAGCATGG + Intronic
1018174582 6:161167686-161167708 CAAGCCTCCAGCTTCCAGCCTGG - Intronic
1019109953 6:169701922-169701944 ACAGCACCCAGCTCCCAGGAGGG + Intronic
1019427904 7:986016-986038 GCAGCCTCCATCTTCCAGGTGGG - Intronic
1019730728 7:2627945-2627967 CCTCCCTCCAGCTGCCAGGAAGG - Intergenic
1020100415 7:5391193-5391215 CCAGGCAGGAGCTGCCAGGAAGG + Intronic
1023736830 7:43242787-43242809 ACAGCCACTGGCTTCCTGGATGG - Intronic
1023904399 7:44512152-44512174 CAAACAACCAGCTCCCAGGAGGG - Intergenic
1026920512 7:74152162-74152184 TCAACCACCAGCTTCTTGGAGGG - Intergenic
1028614973 7:92755801-92755823 CCAACAGTCAGCTTCCAGGAAGG + Intronic
1029545034 7:101206200-101206222 CCATCCCCCAACTCCCAGGACGG + Exonic
1031869501 7:127076655-127076677 TCAGCCACCAGATTCCTGGGCGG - Intronic
1034340296 7:150348633-150348655 CCATCTACCATCTTTCAGGATGG + Intergenic
1034636944 7:152575138-152575160 GCAGTCCCCAGCTGCCAGGAGGG - Intergenic
1035174078 7:157038099-157038121 CCAGCCACACGCTTCTAGGGTGG - Intergenic
1036650318 8:10637999-10638021 CAAGCCACCAGCTTCTGGGGTGG - Intronic
1036711121 8:11079116-11079138 CTAGCCACCTGCTCCCAGGGAGG + Intronic
1036751221 8:11444633-11444655 GCACCCACAGGCTTCCAGGACGG - Exonic
1037736001 8:21566607-21566629 CCAGTGCCCAGCTTCCAGGGAGG - Intergenic
1038228834 8:25682056-25682078 CAACCCTCCAGGTTCCAGGAGGG - Intergenic
1040943362 8:52854828-52854850 TCAGCCACGAGCATCTAGGAAGG - Intergenic
1042203714 8:66307125-66307147 CCATTCACCAGCTGCAAGGAAGG - Intergenic
1042422637 8:68609828-68609850 CCAGCCACTAGTTTCCAGGAAGG + Intronic
1045526659 8:102946169-102946191 CCATCCTCCAGCTTCCATGGTGG + Intronic
1045820224 8:106328566-106328588 CAAACAACCAGCTTCCAGCACGG - Intronic
1048166164 8:132063157-132063179 CCAGGCACAAGCTTCCAGTGGGG - Intronic
1048188287 8:132264352-132264374 CCAGCCCCCAGCTATCAGGAGGG + Intronic
1048926421 8:139276517-139276539 CCAGCCACCAGCCTTCTGCAGGG - Intergenic
1049250215 8:141584182-141584204 TCAGCCTCCAGCCTCCAGAATGG + Intergenic
1049373458 8:142278450-142278472 CCTTCCAGCAGCTCCCAGGAAGG + Intronic
1049381412 8:142318226-142318248 CGGGCCATCAGCTTCCAGTAAGG + Intronic
1049886448 9:30071-30093 CAAGCCAACGGATTCCAGGAGGG - Intergenic
1050710487 9:8456514-8456536 TCAACCAGCAGCTTCCAGTATGG + Intronic
1052019398 9:23508463-23508485 CCATCCTCCAGACTCCAGGATGG + Intergenic
1053145839 9:35711613-35711635 CTCCACACCAGCTTCCAGGAAGG + Exonic
1055296422 9:74837993-74838015 CCAGCCCTCAGCTTCCCGAAAGG + Intronic
1056423324 9:86451721-86451743 CCTGCCTTCAGCTTCCAAGATGG + Intergenic
1056507693 9:87272959-87272981 CCACCCTCCACCTTCAAGGAGGG - Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1057197262 9:93121988-93122010 CCAGCCCCCATGTGCCAGGAGGG + Exonic
1057666094 9:97046516-97046538 TACCCCACCAGCTTCCAGGAGGG + Intergenic
1059242599 9:112820007-112820029 ACAGGCACCAGCTGCCAGGAGGG - Intronic
1060509829 9:124223671-124223693 CCAGCCACCAGTGCCCAGGGAGG - Intergenic
1060706487 9:125806458-125806480 CCAGGCTTCTGCTTCCAGGATGG + Intronic
1060838696 9:126777692-126777714 CCCTCCCCCAGCTCCCAGGAGGG - Intergenic
1061095886 9:128456562-128456584 CCACCCACCAGCAGGCAGGAGGG - Exonic
1061178479 9:129010848-129010870 CCAGCCCCCAGCTCCCATGCCGG - Intronic
1061390314 9:130314135-130314157 GCAACCAGGAGCTTCCAGGATGG - Intronic
1061887888 9:133601959-133601981 CCAGCCCCCAGCTTCCCTGCTGG - Intergenic
1061929007 9:133822674-133822696 CCAGCTACCAGATTCCCGGAAGG + Intronic
1061938937 9:133873844-133873866 CCACCCAGCAACTTCCAGGCAGG + Intronic
1062261724 9:135666247-135666269 CCCTCCACCAGCTCCCGGGAAGG + Intronic
1203433021 Un_GL000195v1:109085-109107 CCAGACACCAGCTTCCTGAAAGG + Intergenic
1203433482 Un_GL000195v1:115495-115517 CCAGACACCAGCTTCCTGAAAGG - Intergenic
1203523468 Un_GL000213v1:65879-65901 CAAGCCACCATCTTCAAGGGAGG + Intergenic
1185830221 X:3294393-3294415 CCAGCCACCTGGCTCCAGGGTGG + Intergenic
1186660606 X:11664865-11664887 AAAGCCACCAGCGTCCAGGGAGG - Exonic
1189266353 X:39719757-39719779 CTAGCCACTAGGTTCCAGGGTGG - Intergenic
1193180122 X:78445160-78445182 CCAGCAACCTGAATCCAGGAAGG - Intergenic
1194634123 X:96322973-96322995 CCAGCCACCCTCTTCAAGGTGGG - Intergenic
1194841686 X:98751989-98752011 CCATCCTCCAGATTCCAGAATGG - Intergenic
1196707291 X:118727532-118727554 CCGGCCCCCAGCCTCCAGGGCGG + Intergenic
1196903489 X:120409736-120409758 CCATCCTCCAGATTCCAGAATGG - Intergenic
1198297480 X:135301759-135301781 CCATCCTCCAGATTCCAGAAGGG - Intronic
1198839098 X:140837073-140837095 CTGTCCAACAGCTTCCAGGATGG - Intergenic
1199691445 X:150311899-150311921 CATGCTTCCAGCTTCCAGGATGG - Intergenic
1199953346 X:152723051-152723073 CCAGCCCCCAGCATGCATGAAGG - Intergenic
1199956336 X:152745399-152745421 CCAGCCCCCAGCATGCATGAAGG + Intergenic
1200179325 X:154140827-154140849 CCAGCCCCCACATCCCAGGAAGG - Intergenic
1201282788 Y:12355723-12355745 ACAGCCACCTGCTTCAAGCAGGG + Intergenic
1201392477 Y:13513228-13513250 CCAGCCCCCAGGTTTCAGGCTGG + Intergenic