ID: 907424893

View in Genome Browser
Species Human (GRCh38)
Location 1:54373358-54373380
Sequence CTCTGTAACTAGAATCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907424893_907424897 11 Left 907424893 1:54373358-54373380 CCTTCATGATTCTAGTTACAGAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 907424897 1:54373392-54373414 TACACGAATCCAGCCAATCTGGG 0: 1
1: 0
2: 0
3: 3
4: 44
907424893_907424898 18 Left 907424893 1:54373358-54373380 CCTTCATGATTCTAGTTACAGAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 907424898 1:54373399-54373421 ATCCAGCCAATCTGGGCCTCTGG 0: 1
1: 0
2: 1
3: 19
4: 137
907424893_907424899 19 Left 907424893 1:54373358-54373380 CCTTCATGATTCTAGTTACAGAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 907424899 1:54373400-54373422 TCCAGCCAATCTGGGCCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 185
907424893_907424903 29 Left 907424893 1:54373358-54373380 CCTTCATGATTCTAGTTACAGAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 907424903 1:54373410-54373432 CTGGGCCTCTGGGGCTGCCCTGG 0: 1
1: 1
2: 8
3: 77
4: 844
907424893_907424901 20 Left 907424893 1:54373358-54373380 CCTTCATGATTCTAGTTACAGAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 907424901 1:54373401-54373423 CCAGCCAATCTGGGCCTCTGGGG No data
907424893_907424896 10 Left 907424893 1:54373358-54373380 CCTTCATGATTCTAGTTACAGAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 907424896 1:54373391-54373413 TTACACGAATCCAGCCAATCTGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907424893 Original CRISPR CTCTGTAACTAGAATCATGA AGG (reversed) Intronic
900118553 1:1038955-1038977 CACTGTAAGTATAGTCATGAGGG - Intronic
900201393 1:1408539-1408561 CTCTGTAAATATAAACATAATGG + Intergenic
900839488 1:5036582-5036604 GTCTGTATCTGGAAGCATGAGGG - Intergenic
904570094 1:31457311-31457333 CTCTTTAACAAAAATCATAAAGG - Intergenic
907424893 1:54373358-54373380 CTCTGTAACTAGAATCATGAAGG - Intronic
907670319 1:56468835-56468857 CTCTTTAACTAGAATCGTCAAGG - Intergenic
910825482 1:91403406-91403428 TTATGTAAATAAAATCATGAAGG + Intronic
919121659 1:193348689-193348711 CTCTGTAAGTAGATTCTTGCTGG + Intergenic
919335982 1:196234442-196234464 CTATGTAAATAGATTTATGAAGG - Intronic
923770190 1:236931519-236931541 CTCTGTAACCCGAATCATCCAGG + Intergenic
1067961455 10:50856309-50856331 CTCTGTAGCCAAAATCAGGAGGG + Intronic
1070090635 10:73281959-73281981 CTCTTTCACTAGAATCACGTCGG - Intronic
1070322016 10:75361762-75361784 CTCTGTACCTAGATTTATGGGGG - Intergenic
1071099296 10:82016384-82016406 CTCTGCCACCAGAAGCATGAAGG + Intronic
1071202114 10:83230612-83230634 CTTAGTAACTAGAATCATCAAGG - Intergenic
1073469345 10:103713173-103713195 CTCTGTAAGTTGGATCTTGAGGG - Intronic
1074428795 10:113375119-113375141 CTCTCAAACTAGAATCATCCTGG - Intergenic
1075781136 10:125017955-125017977 CTCTGGAGCAAGAGTCATGACGG - Intronic
1076503064 10:130952197-130952219 GTCTGTAACTAGAAACCTGACGG + Intergenic
1079929964 11:26546074-26546096 CTCTGTCACCAAAATCATAAAGG + Intronic
1081124285 11:39303532-39303554 CTCTGTAAATAGAATCTTTCTGG - Intergenic
1084303990 11:68269942-68269964 CTATGTAAGTTGACTCATGATGG + Intronic
1084560005 11:69899303-69899325 CTCTGTAACCAGAATGGGGAGGG - Intergenic
1085237161 11:75023986-75024008 CTCTGTAAAGAGAGACATGAAGG - Intergenic
1085451100 11:76633949-76633971 CTCTGTAGCTAGAAAAAGGAAGG - Intergenic
1092742392 12:11642515-11642537 CACCATAACTAGAATCATAAAGG - Intergenic
1096192573 12:49630093-49630115 CTCTGTAACTGGGATAATTAGGG + Intronic
1097549357 12:61047577-61047599 CTTTGTAACTGTAGTCATGAGGG - Intergenic
1097629883 12:62047787-62047809 ATCTGGAACTATAATCTTGAAGG - Intronic
1097719737 12:63007220-63007242 CTTTGTAACAAGAATCTGGAGGG + Intergenic
1099195626 12:79611910-79611932 TTCTTTAATTAGAATCAAGAGGG - Intronic
1104103446 12:125636776-125636798 CTCTGCAGCCAGGATCATGAAGG + Intronic
1104169858 12:126269577-126269599 CTCTGTAAGAGGAATCATGAAGG + Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107380971 13:39856394-39856416 CTCAGTAGCTAAAATGATGAAGG + Intergenic
1108466299 13:50719161-50719183 CCCTGCAATTAGAATGATGAGGG - Intronic
1109233281 13:59784901-59784923 CTCTATAACCAGAATCATAGAGG - Intronic
1112511543 13:100013751-100013773 CCCTCTAACTAGAATAATTAAGG + Intergenic
1114144555 14:19959081-19959103 CTCTGTCAATAGAATTATAATGG + Intergenic
1115011564 14:28553879-28553901 CTCTGTCACTAGAATCTTTGAGG - Intergenic
1119314872 14:73684963-73684985 CTCTGTAAATAATATCATGTTGG - Intronic
1120120522 14:80674330-80674352 CTCTATAATAAGAATGATGATGG - Intronic
1121158069 14:91705761-91705783 CACTGTAACTAGAAGAATCAGGG + Intronic
1126648881 15:50901951-50901973 CTCTGACATTAGAATCATAAAGG + Intergenic
1130804696 15:87307464-87307486 CTCTTTAACTAGGCTCATGAAGG - Intergenic
1131796629 15:96024320-96024342 CTCTCCAACTAGAAGTATGATGG - Intergenic
1132788256 16:1670293-1670315 CTCTGTGACTAGTCTCATGCAGG - Intronic
1133882447 16:9795597-9795619 TTCTGTAACTACAATGGTGATGG + Intronic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1135841180 16:25877770-25877792 CTCTGTAGTAAGAATCATCATGG - Intronic
1136506398 16:30706761-30706783 CCTTGTATCTAGAATCAAGAGGG + Intronic
1136708381 16:32210454-32210476 GTCTGCAATTAGAATCATTAAGG - Intergenic
1137051064 16:35713492-35713514 CTCTGTAATTAGAATTATTTGGG + Intergenic
1137724710 16:50649483-50649505 CTCAGTAACTGGAGTGATGAGGG - Intergenic
1137862394 16:51859119-51859141 TTCTGAAACTAGAATAAAGAGGG - Intergenic
1138204962 16:55117968-55117990 TTCTGTAACTAGAACCTTGAAGG - Intergenic
1138851948 16:60640284-60640306 ACCTTTAACTAGAATGATGACGG - Intergenic
1142188075 16:88703963-88703985 CTCTGTAACCAGAAGCCTGTGGG - Intronic
1142851429 17:2706633-2706655 CTCTGTCACTAGAGTCAGGCAGG - Intronic
1156136801 18:34050165-34050187 CTCTGAAAAGAGGATCATGAAGG - Intronic
925170393 2:1746623-1746645 GTGTGTAGCTAGAATCATGCTGG - Intergenic
925555152 2:5122584-5122606 TCCTGTAGCTAGAATCAAGAAGG + Intergenic
927501410 2:23585724-23585746 ATATGTAACTAGAAGCAGGAGGG + Intronic
929086835 2:38176414-38176436 CTGTCTAACTAAAATTATGAAGG + Intergenic
930521206 2:52469920-52469942 CTCTGGAAACATAATCATGATGG - Intergenic
935009362 2:99117821-99117843 CTGTGTGACTGGAATCAGGAAGG + Intronic
935407179 2:102721328-102721350 GCCTGTAACTTGAATCAGGAGGG - Intronic
936075206 2:109397396-109397418 CTATGATACTAGAATCATCATGG - Intronic
936541800 2:113358234-113358256 CTCTGAAAATAGTTTCATGAAGG + Intergenic
938605997 2:132893568-132893590 CTTTGTATGTAGAATCATGTTGG - Intronic
941512549 2:166431288-166431310 CTCTCTAACTAAAATAAAGATGG + Intronic
944530831 2:200666318-200666340 CTTTGCAACTAGGATCGTGAGGG + Intronic
945657872 2:212647303-212647325 CTCTAAAACTAGTTTCATGATGG - Intergenic
1171067677 20:22034417-22034439 CTCTTTAACAAGATTCTTGAAGG + Intergenic
1176690793 21:9905815-9905837 ATCTGTAAGTTCAATCATGAAGG + Intergenic
1178155990 21:29854710-29854732 CTCAGGAACTAGGATCATGATGG + Intronic
1178459897 21:32793463-32793485 CTCTGCAACTAGAAGCCTGCAGG - Exonic
1182824283 22:33250578-33250600 CTCTTTCACTAAAATCAGGAAGG - Intronic
949597841 3:5566454-5566476 CAGTTTAACTAGAATCATCATGG + Intergenic
949700564 3:6752261-6752283 CTCTGGAACTAGAACCAAGATGG + Intergenic
949792712 3:7810667-7810689 CTCTGTCAGTAGAAGCATTAAGG - Intergenic
955572633 3:60324282-60324304 CTTAGTAACTGGAATCTTGAGGG - Intronic
955801627 3:62692904-62692926 ATCTGTATCTAGAATGATCATGG + Intronic
958537221 3:95418856-95418878 CCCTGAAACTAGGATCCTGAGGG + Intergenic
960386061 3:117023416-117023438 ATCTGCAACTGGAATCATGGTGG + Intronic
960784562 3:121357733-121357755 CTCTGTAACTATGATGGTGATGG + Intronic
967420486 3:189266812-189266834 CTTTGTAACTAGAAAGATCAAGG - Intronic
967465943 3:189806251-189806273 CTGTGTAGCTAGAAGCAGGAGGG + Intronic
970308142 4:14754132-14754154 CTCTGAAATTAGCATCATAATGG + Intergenic
971331971 4:25689075-25689097 CTCTGCAACTGGAAGCATGAAGG + Intergenic
971659161 4:29389810-29389832 CTGTGTAGCTAGAAGCAAGATGG - Intergenic
972389609 4:38602356-38602378 GTCTGCAACTAGATTCTTGATGG + Intergenic
974820346 4:67059575-67059597 CTATGTCACTTGAATCATGGAGG + Intergenic
975838700 4:78451877-78451899 CTCTTTACCTAGAATGCTGATGG - Intronic
977350126 4:95873810-95873832 CTCTCTAAATAGACTCATGCTGG + Intergenic
977436865 4:97008454-97008476 CTCTGTATCTTGAATGATGGTGG - Intergenic
980363372 4:131766055-131766077 ATCTGTAAGTTCAATCATGAAGG + Intergenic
980515535 4:133853198-133853220 CTATTTAACTAGAATCATACTGG - Intergenic
980864098 4:138533867-138533889 CTTTGAAACTATATTCATGAGGG - Intergenic
985875990 5:2595068-2595090 CTCTGTGACCAGAATCAATAGGG + Intergenic
986150685 5:5127314-5127336 CTCCGGAATGAGAATCATGATGG + Intergenic
989723605 5:44559846-44559868 CTCTGAAGTTAGAATTATGAGGG + Intergenic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
990698574 5:58450706-58450728 GGCAGAAACTAGAATCATGATGG - Intergenic
998681984 5:144478295-144478317 GTCTGAAACCAGAATGATGAAGG - Exonic
999410433 5:151345510-151345532 CTCTGTACATAGATTCATCAAGG + Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003473955 6:6463972-6463994 CTCTGTAGCTATTATGATGAGGG - Intergenic
1007008473 6:38391281-38391303 ATCTGTTAATAGAATGATGAAGG + Intronic
1007979299 6:46134158-46134180 CTTTGTAACTAGAATGATAAAGG + Intronic
1011755050 6:90490121-90490143 ATCTGTGACTAGAACAATGAAGG - Intergenic
1013636948 6:112038091-112038113 GGCTGCAACTAGAATCATGTGGG - Intergenic
1014931339 6:127340326-127340348 CTCAGTAAATAGAATGAAGAAGG - Intronic
1015627533 6:135195999-135196021 TTCTGTAAGTAGAATTGTGAAGG + Exonic
1015704132 6:136068729-136068751 CTGTGTAATAAGAATCTTGAAGG - Intronic
1016241504 6:141936715-141936737 CTCTGTCACTAAAATCAGCAAGG - Intergenic
1020211492 7:6161271-6161293 GTCTGTAACTAGAAACTCGAAGG - Exonic
1022778224 7:33550009-33550031 CTCTAAAAATAAAATCATGAAGG + Intronic
1023339090 7:39200300-39200322 CTCTGTCAGTAGCCTCATGAGGG + Intronic
1023527672 7:41121801-41121823 CTCCGTAACTAGCAACAGGATGG + Intergenic
1026602488 7:71788128-71788150 TTCTATAACAAGAATCATGATGG + Intronic
1027730330 7:81863550-81863572 TTCAGCAACTAGAATCATCATGG + Intergenic
1032405075 7:131650008-131650030 CTCTGGAACTGGAATCCTGCCGG + Intergenic
1032825160 7:135561582-135561604 CTCTGTGACTAGAAGTCTGAGGG - Intronic
1033015072 7:137663024-137663046 CTGGGTATCTGGAATCATGATGG + Intronic
1035009083 7:155696444-155696466 CTCTGTGACTAGAAACATTCAGG + Intronic
1036035230 8:5011554-5011576 CTCTGGAATTAGGATGATGAGGG - Intergenic
1039654582 8:39388033-39388055 CTTTGTAACCAAATTCATGAGGG + Intergenic
1041255228 8:55974512-55974534 CTCAGTAGCTACAACCATGAGGG - Intronic
1045467149 8:102480792-102480814 CTCTCTAAGTGGAATGATGACGG + Intergenic
1046454489 8:114440631-114440653 CTCTGTAACTAGGATCCCGGAGG - Intergenic
1047458200 8:125036184-125036206 CTGTGTATCTGGAACCATGATGG - Intronic
1053627525 9:39890331-39890353 ATCTGTAAGTTCAATCATGAAGG + Intergenic
1053778468 9:41575689-41575711 ATCTGTAAGTTCAATCATGAAGG - Intergenic
1054166430 9:61785933-61785955 ATCTGTAAGTTCAATCATGAAGG - Intergenic
1054216362 9:62360372-62360394 ATCTGTAAGTTCAATCATGAAGG - Intergenic
1054671119 9:67794971-67794993 ATCTGTAAGTTCAATCATGAAGG + Intergenic
1055022044 9:71680437-71680459 CTGTGTAGATAGAATCATTAAGG + Intergenic
1056761500 9:89418799-89418821 CTGTGTTAATAGAATCATGGAGG - Exonic
1059904957 9:118972396-118972418 TTTTGTCACTAGACTCATGAGGG - Intergenic
1060015133 9:120080472-120080494 CACTGTCACCAGAATCAAGAAGG + Intergenic
1186069836 X:5807434-5807456 CACTATAAATAGACTCATGAAGG + Intergenic
1194297903 X:92149195-92149217 CTCAGTAATTATAATTATGAAGG + Intronic
1195853521 X:109307771-109307793 CTCTCTTACCACAATCATGAGGG - Intergenic
1196245652 X:113396261-113396283 CTCTGGAACTAGAGTCTTTAAGG - Intergenic
1196350899 X:114727696-114727718 CTCTTTTACAAGAATCATAAAGG - Intronic
1199370277 X:147040133-147040155 CTCTTTAAATGGAATCAGGAAGG - Intergenic
1200615512 Y:5374165-5374187 CTCAGTAATTATAATTATGAAGG + Intronic