ID: 907425269

View in Genome Browser
Species Human (GRCh38)
Location 1:54375536-54375558
Sequence CTGGAGTCACAGTCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907425269_907425272 5 Left 907425269 1:54375536-54375558 CCAGCAGCTGACTGTGACTCCAG No data
Right 907425272 1:54375564-54375586 CTTCAAGAGTGTCAAGTTGTGGG 0: 1
1: 0
2: 0
3: 10
4: 157
907425269_907425271 4 Left 907425269 1:54375536-54375558 CCAGCAGCTGACTGTGACTCCAG No data
Right 907425271 1:54375563-54375585 TCTTCAAGAGTGTCAAGTTGTGG 0: 1
1: 0
2: 0
3: 19
4: 210
907425269_907425273 11 Left 907425269 1:54375536-54375558 CCAGCAGCTGACTGTGACTCCAG No data
Right 907425273 1:54375570-54375592 GAGTGTCAAGTTGTGGGCCCAGG No data
907425269_907425274 18 Left 907425269 1:54375536-54375558 CCAGCAGCTGACTGTGACTCCAG No data
Right 907425274 1:54375577-54375599 AAGTTGTGGGCCCAGGAGACAGG 0: 1
1: 0
2: 3
3: 32
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907425269 Original CRISPR CTGGAGTCACAGTCAGCTGC TGG (reversed) Intronic
No off target data available for this crispr