ID: 907426817

View in Genome Browser
Species Human (GRCh38)
Location 1:54384998-54385020
Sequence CTCCAGAGTAGGCCTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907426809_907426817 -4 Left 907426809 1:54384979-54385001 CCCAGCTGCCTGTCCACGTCTCC No data
Right 907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG No data
907426810_907426817 -5 Left 907426810 1:54384980-54385002 CCAGCTGCCTGTCCACGTCTCCA 0: 1
1: 0
2: 0
3: 24
4: 267
Right 907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG No data
907426808_907426817 -3 Left 907426808 1:54384978-54385000 CCCCAGCTGCCTGTCCACGTCTC 0: 1
1: 0
2: 1
3: 18
4: 289
Right 907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG No data
907426803_907426817 24 Left 907426803 1:54384951-54384973 CCCTGTCTCCTCTCTGGCTAATG No data
Right 907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG No data
907426807_907426817 16 Left 907426807 1:54384959-54384981 CCTCTCTGGCTAATGGTGGCCCC 0: 1
1: 0
2: 2
3: 10
4: 118
Right 907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG No data
907426804_907426817 23 Left 907426804 1:54384952-54384974 CCTGTCTCCTCTCTGGCTAATGG 0: 1
1: 0
2: 2
3: 18
4: 227
Right 907426817 1:54384998-54385020 CTCCAGAGTAGGCCTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907426817 Original CRISPR CTCCAGAGTAGGCCTGGGCA GGG Intronic
No off target data available for this crispr