ID: 907427019

View in Genome Browser
Species Human (GRCh38)
Location 1:54386343-54386365
Sequence CCGTGGGGCATTTTATCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907427019_907427026 -2 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427026 1:54386364-54386386 GGGCACAGCACCTTATGGAGCGG No data
907427019_907427032 27 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427032 1:54386393-54386415 TCATCAACTCCCAGGAGCTGGGG 0: 1
1: 0
2: 3
3: 22
4: 255
907427019_907427028 19 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427028 1:54386385-54386407 GGTCCACATCATCAACTCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 90
907427019_907427030 25 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427030 1:54386391-54386413 CATCATCAACTCCCAGGAGCTGG No data
907427019_907427024 -7 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427024 1:54386359-54386381 CCCACGGGCACAGCACCTTATGG No data
907427019_907427033 30 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427033 1:54386396-54386418 TCAACTCCCAGGAGCTGGGGAGG 0: 1
1: 0
2: 1
3: 40
4: 332
907427019_907427031 26 Left 907427019 1:54386343-54386365 CCTTCAGATAAAATGCCCCACGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 907427031 1:54386392-54386414 ATCATCAACTCCCAGGAGCTGGG 0: 1
1: 0
2: 2
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907427019 Original CRISPR CCGTGGGGCATTTTATCTGA AGG (reversed) Intronic
907427019 1:54386343-54386365 CCGTGGGGCATTTTATCTGAAGG - Intronic
908408053 1:63834192-63834214 GCATGGGGCATTTGAGCTGAGGG + Intronic
909595663 1:77403609-77403631 CCATGCGGCATTATTTCTGAGGG + Intronic
911519248 1:98908879-98908901 CCCTGGGGGAGTTTTTCTGAGGG + Intronic
911991764 1:104707049-104707071 CCGTGACGCATTTTAGCTCAGGG + Intergenic
913419220 1:118646173-118646195 CTGTGAGGCTTTTTCTCTGAAGG - Intergenic
914907095 1:151755550-151755572 CTGTGGTGGATGTTATCTGATGG - Intergenic
915640316 1:157219505-157219527 CCCAGGGGCATTTTATCAGTGGG + Intergenic
916471146 1:165124038-165124060 CAGTGAGGCATTTTGGCTGAGGG - Intergenic
916507805 1:165443810-165443832 CCGTGGACCAATTCATCTGAAGG - Intronic
922402000 1:225269157-225269179 ACGTGTGGCATTATTTCTGAGGG - Intronic
1064031512 10:11886032-11886054 CCGAGGGGGCTTTTATCTGGGGG - Intergenic
1064640579 10:17411545-17411567 CAGTGGGGCATTTTATCAGCTGG - Intronic
1071335219 10:84594848-84594870 CCTTGGGGCACTTTATGTGTGGG + Intergenic
1071560084 10:86639149-86639171 TCATGGGGCATTTCATCTGAAGG + Intergenic
1075397859 10:122140963-122140985 CTGTGGGGCCTTGGATCTGAGGG + Intronic
1079946806 11:26753527-26753549 CCTTGTGTCATTTTATCTGATGG - Intergenic
1080273693 11:30479051-30479073 CCGTGGGACATTTTCCCAGAGGG + Intronic
1081440179 11:43072247-43072269 CCTTGGGGTTCTTTATCTGAGGG - Intergenic
1086193646 11:84110655-84110677 AGGTGGGGCCTTTTCTCTGATGG - Intronic
1087691289 11:101323461-101323483 CCATGGGGCCTTGTATCAGAAGG + Intergenic
1099399076 12:82180081-82180103 ATGTGTGGCATTTTTTCTGAGGG + Intergenic
1100171265 12:91977709-91977731 ATGTGGGGCAATTTAACTGAGGG + Intergenic
1100811327 12:98341442-98341464 CCATGGAGCATTTTGTTTGAAGG - Intergenic
1104140711 12:125983848-125983870 CTGTGGGGCATTTGCTCTGCTGG + Intergenic
1122147731 14:99703143-99703165 CTGTGGGGCATTGTATCAGGAGG + Intronic
1122746292 14:103898990-103899012 CCGGGGGGCTTTTCTTCTGAAGG + Intergenic
1124891242 15:33735302-33735324 CCCTGGGGCTTTTTATCACAAGG + Intronic
1127808945 15:62546555-62546577 CCTGGGGGCATGTTGTCTGAAGG + Intronic
1134778881 16:16877503-16877525 GCATGGGGCATCTTATTTGAAGG - Intergenic
1141336071 16:83156591-83156613 CCATGGTGCCTTTTATCTGGAGG - Intronic
1142979020 17:3660860-3660882 CCATGGGGCTCTTTCTCTGAAGG + Exonic
1144852035 17:18248766-18248788 CCGTGGGGTCTTTTGTGTGAAGG - Intronic
1149037621 17:52153318-52153340 GGGTGGGGCTTTTTATTTGATGG + Intronic
1157609219 18:48945787-48945809 CCGTGTTTCATTGTATCTGATGG - Intronic
1159509539 18:69378562-69378584 AGGTGGGGCATTTTCTCTGGTGG + Intergenic
1160063323 18:75551507-75551529 ACGTGGGTTATGTTATCTGACGG - Intergenic
1161219494 19:3111815-3111837 CCCTGGGGCCTTTCAGCTGAGGG + Intronic
927964706 2:27262027-27262049 CCGTGGGCCATCTTGTCTGTCGG - Intronic
930417650 2:51109145-51109167 CAGGGGGACATTTTATCTAAGGG + Intergenic
935194128 2:100801542-100801564 CCCTGGTACATTTTATCTCAGGG - Intergenic
947223874 2:227821649-227821671 CATTGAGGCCTTTTATCTGAGGG - Intergenic
1179125267 21:38584635-38584657 CAATGGGGCATCTTATCTCAGGG + Intronic
1179392538 21:41007018-41007040 CAGTGGGGCATTTTATTGAAAGG + Intergenic
1180333619 22:11555828-11555850 CCGTGGGGCCTCTTATCAGCTGG + Intergenic
1184980471 22:48091849-48091871 CCGTGGGCCAGCTCATCTGATGG + Intergenic
955505450 3:59628523-59628545 ACGTGTGGCATTATTTCTGAGGG - Intergenic
956354986 3:68381082-68381104 ACGTGTGGCATTATTTCTGAGGG + Intronic
962031156 3:131601759-131601781 CTCTGGGGCATGTAATCTGAGGG - Intronic
980822849 4:138039064-138039086 CAGTGGGTCATTTTTTCTGGAGG - Intergenic
981251885 4:142612695-142612717 CCCTGGGGCCTTTTTTATGAGGG + Intronic
986512965 5:8528382-8528404 CCTTGGGGCATTTTAGATGATGG - Intergenic
996942071 5:129020361-129020383 CCATCAGGCATTTTAACTGAAGG - Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1005318866 6:24631793-24631815 CCTTGGGGCATGTTTTCTAAAGG - Intronic
1020620008 7:10505768-10505790 ACGTGTGGCATTATTTCTGAGGG - Intergenic
1021987848 7:26114378-26114400 CCATGGGGCAGTATATCTGAAGG - Intergenic
1028477971 7:91272428-91272450 CAGTTGGTCATTCTATCTGAGGG - Intergenic
1030070800 7:105695868-105695890 GCGTTGGGCATTTGCTCTGAGGG + Intronic
1031845838 7:126805259-126805281 AGGTGGGGCATCTTATGTGATGG - Intronic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1035354533 7:158269156-158269178 CTTTGGGGCATTTTCCCTGAAGG - Intronic
1039854038 8:41397402-41397424 CAGTGGGTCATTTTGGCTGAAGG - Intergenic
1041980463 8:63852557-63852579 CTGTGGGGCATTTTCTCCCAGGG + Intergenic
1046924924 8:119775827-119775849 CCCAGGGAAATTTTATCTGATGG - Intronic
1048704898 8:137142706-137142728 CCGTTGGACATTTTATCCTAAGG + Intergenic
1053505709 9:38641675-38641697 CCGTGGGGGATTTTCTCTCTCGG + Intergenic
1057077327 9:92144999-92145021 CCGTGGGACATCCAATCTGATGG + Intergenic
1061283328 9:129609577-129609599 CCGTGGGGCATTTCCACTCAGGG - Intronic
1189625921 X:42896357-42896379 TCCTGGGGCATATTATATGATGG - Intergenic
1189877735 X:45454369-45454391 CAGTGGGACATTGTATGTGAAGG + Intergenic
1191164809 X:57377458-57377480 ATGTGTGGCATTATATCTGAGGG + Intronic
1198173135 X:134127536-134127558 TCTTGGGGCATTGTATTTGAAGG + Intergenic