ID: 907427291

View in Genome Browser
Species Human (GRCh38)
Location 1:54388423-54388445
Sequence CCAGGCCAGGCACTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907427291_907427298 -5 Left 907427291 1:54388423-54388445 CCCACACACAGTGCCTGGCCTGG 0: 1
1: 0
2: 4
3: 31
4: 334
Right 907427298 1:54388441-54388463 CCTGGGGTAAATGCAGTAAATGG No data
907427291_907427299 -2 Left 907427291 1:54388423-54388445 CCCACACACAGTGCCTGGCCTGG 0: 1
1: 0
2: 4
3: 31
4: 334
Right 907427299 1:54388444-54388466 GGGGTAAATGCAGTAAATGGTGG 0: 1
1: 0
2: 1
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907427291 Original CRISPR CCAGGCCAGGCACTGTGTGT GGG (reversed) Intronic
900314308 1:2049568-2049590 CGAGGCCAGGAACTGGGTCTGGG + Intergenic
900474406 1:2869472-2869494 CCAGGCCAGGCTCTGGGAGCTGG - Intergenic
900596448 1:3482230-3482252 CCAGGGCAGGGCATGTGTGTTGG + Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
900687485 1:3958125-3958147 CCAGGCCAGCCACTCAGTGAGGG - Intergenic
900743562 1:4344930-4344952 CCAGGCCAGGCACAGTAGGTGGG - Intergenic
900966580 1:5962861-5962883 GCAGCCCAGGCCCTGTGTTTCGG - Intronic
901642315 1:10698998-10699020 CCAGGCCAGGCCATGGGTGGGGG - Intronic
901789571 1:11647251-11647273 CCAGGCCAGGTCATGTGTGGGGG - Intergenic
901897819 1:12329558-12329580 CCAGGGCTGGCACTGTGGGAAGG + Intronic
902623525 1:17664095-17664117 CCATGCCATGCACTGGGTGCTGG - Intronic
902979875 1:20114996-20115018 CCAGCCCAGGCTCTGTCAGTTGG + Intronic
903215060 1:21839215-21839237 CCAGGCCAGGGTGTGGGTGTCGG + Intronic
903348945 1:22706650-22706672 CCTGGCCTGGCACTGGCTGTAGG + Intergenic
903646014 1:24896923-24896945 CCAGGGCAGGCCCTTTCTGTGGG + Intergenic
903993996 1:27293724-27293746 CCAAGCCATGCAGTGTGTGAGGG - Intronic
904368661 1:30034779-30034801 CCAGGCCGGGCACCCTGTGATGG - Intergenic
904529660 1:31160076-31160098 TCAGGCCAGGCTCTGTCGGTGGG + Intergenic
905143038 1:35864221-35864243 ATATGCCAGACACTGTGTGTTGG - Intergenic
906349220 1:45043218-45043240 CAAGGCCAGCCACTGTGGCTTGG - Exonic
906391724 1:45423025-45423047 ACAGGCCAGGCACGGTGGCTGGG - Intronic
906812241 1:48839770-48839792 CCAGGACGAGCACTGTATGTGGG - Intronic
906992314 1:50752260-50752282 CCATGCCAGGCCCTTTTTGTGGG + Intronic
907285903 1:53379416-53379438 CCGGGCCTGTTACTGTGTGTGGG + Intergenic
907427291 1:54388423-54388445 CCAGGCCAGGCACTGTGTGTGGG - Intronic
907450267 1:54541944-54541966 CCAGACCACGCACTGTGTCCTGG - Intergenic
907490548 1:54806316-54806338 CCAGGCTCAGCCCTGTGTGTAGG - Intronic
911048513 1:93649382-93649404 CCAAGCCAGGTGCTGTGTGTGGG - Intronic
912595774 1:110874358-110874380 TGAGGCCAGGCACTGTGCTTTGG + Intronic
913075950 1:115340431-115340453 ATATGCCAGGCACTGTGTGCTGG + Intergenic
913217501 1:116632732-116632754 CCAGGCCAGGCTCTGTGGGCTGG - Intronic
914913063 1:151802110-151802132 CTAGGCCAGGCACTGTGCTGAGG + Exonic
915090414 1:153420223-153420245 CCAGGCCAGGCAGTGTGTTATGG + Exonic
915095077 1:153456870-153456892 CCAGGCCAGGCAGTGTGCTATGG - Intergenic
915937499 1:160098052-160098074 CCAGGCCTGGAGCTGAGTGTGGG + Intronic
917635064 1:176927656-176927678 ACATGCCAGGCACTGTGTCAGGG + Intronic
918250619 1:182699939-182699961 CCAGGGCAGGCACTGTGTGAGGG - Intergenic
918267868 1:182863733-182863755 ACAGGACAGGCATTTTGTGTGGG - Intronic
918323376 1:183385865-183385887 TGAGGACAGGCACTGTGTCTTGG - Intronic
920236430 1:204509536-204509558 CCAGTCAGGGCACTGTATGTTGG + Intergenic
922498097 1:226076432-226076454 CCAGGCCAGGCGCCGTGGCTCGG - Intergenic
922896782 1:229106899-229106921 CCAGGCCAGTCCCTGGGTGTTGG + Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
1062939115 10:1408824-1408846 CCAGGCCACTCCCTGTGTGCTGG - Intronic
1063910826 10:10828493-10828515 GGCGGTCAGGCACTGTGTGTGGG + Intergenic
1066621183 10:37352668-37352690 TGAGGCCCGGCACAGTGTGTGGG - Intronic
1067087868 10:43252385-43252407 CCTGGCCAGGCACTTGGAGTTGG + Intronic
1071529304 10:86377014-86377036 CCAGGTCAGGCACAGAGTGAGGG - Intergenic
1072204647 10:93192424-93192446 CCAGCCCAGACACTCTGTCTTGG + Intergenic
1073761254 10:106631182-106631204 CCCAGCCAAGCATTGTGTGTGGG + Intronic
1074355844 10:112782365-112782387 TCAGGCCAGGCCCTGCGTGAAGG + Intronic
1075517127 10:123118169-123118191 CCAGTCCAGGCACTGGGTGGCGG - Intergenic
1075631838 10:124005162-124005184 CCAGGCAAGGCCCTGTGACTGGG - Intergenic
1076351229 10:129816332-129816354 CCTGGCCATGCAGTGGGTGTGGG - Intergenic
1076735234 10:132456014-132456036 CCAGGCCAGCCCCTCTCTGTAGG + Intergenic
1077032614 11:476347-476369 CCAGGCCTTTCACTGTGTGACGG - Intronic
1077300175 11:1843088-1843110 CCAGGCAAGGCCCAGGGTGTAGG + Intergenic
1077382206 11:2249468-2249490 CCAGCCCAGGCTCTGTTTCTAGG + Intergenic
1077786517 11:5390097-5390119 CCAGGCCTGCTACTGTGTGCAGG - Exonic
1080008219 11:27431588-27431610 CCAGGCTAGGCAGTGTCTTTGGG - Intronic
1081660814 11:44887328-44887350 ACAGGCCAGGCACTGGGTTAAGG - Intronic
1081684479 11:45032532-45032554 CCAGCAGAGGCACAGTGTGTGGG - Intergenic
1081730512 11:45368832-45368854 CCAGGCCAAGCAGTGTGTGTGGG + Intergenic
1082030133 11:47597833-47597855 CCTGGTCAGGAACTGTCTGTGGG - Intergenic
1083140673 11:60718684-60718706 CCAGCCCAGGAACTGTGGGCTGG - Intergenic
1083322748 11:61857363-61857385 CCAGGCCCAGCACTGAGTGCAGG - Intronic
1083731759 11:64656100-64656122 CCCGCCCAGGCCCTGTGGGTTGG + Intronic
1084359392 11:68659817-68659839 AGATGCCTGGCACTGTGTGTCGG - Intergenic
1084448193 11:69216566-69216588 CCTCGCCAGGCTCTGTGTGAAGG - Intergenic
1084578461 11:70006481-70006503 GTAGGCCAGGGTCTGTGTGTGGG - Intergenic
1084597309 11:70124654-70124676 CCAGGCCAGGCAGTGAATTTAGG - Intronic
1084660655 11:70544612-70544634 CCAGGCCAGGGAGGGGGTGTTGG - Intronic
1084883780 11:72190234-72190256 CCATCCCCAGCACTGTGTGTTGG + Exonic
1085374276 11:76044343-76044365 CCATGTCAGGCTCTGTGTGCTGG - Intronic
1085478802 11:76805225-76805247 TGAGGCCAGTCACTGTGTGGGGG + Intergenic
1085510008 11:77083381-77083403 CCAGCTCAGCCACGGTGTGTGGG + Intronic
1086145711 11:83549206-83549228 CCAAGCCAGGCACAGTGGGATGG - Intronic
1086502858 11:87471366-87471388 CCAGACCAGGCACAGTGGGGAGG + Intergenic
1089788119 11:120922590-120922612 TCTGGCCAGGAACTGTGAGTTGG - Intronic
1089836114 11:121372195-121372217 ACAGGCCTGGCCCTGTGTCTTGG + Intergenic
1091323028 11:134665050-134665072 ACAGGCCAGGCGCTGAGGGTGGG + Intergenic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1093798295 12:23340186-23340208 CCAGGTCAAGCATTGTGTGAAGG - Intergenic
1095282817 12:40375762-40375784 ATAGGCCAGGCACTGTGTGGTGG - Intergenic
1095734095 12:45537444-45537466 GCAGGGCAGGCACAGTGTCTGGG - Intergenic
1096715074 12:53486409-53486431 CCAGGGCAGGGGCTGGGTGTTGG - Intronic
1098398572 12:70049115-70049137 AAAGGCCAGGCAAGGTGTGTTGG + Intergenic
1098929882 12:76398964-76398986 CCAGGCCAGGCAACGTGTTGGGG + Intronic
1099968749 12:89478517-89478539 CAGTGCCAGGCACTGTGTCTGGG - Intronic
1100398255 12:94203749-94203771 ATAGGCCAGGCACTGTTTCTGGG - Intronic
1100965305 12:100006642-100006664 CCATGCAAGGCAGTGTATGTAGG + Intergenic
1101270415 12:103137857-103137879 AGAGGCCAGGCAGGGTGTGTGGG + Intergenic
1101676708 12:106923776-106923798 GCAGGCAAGACAGTGTGTGTAGG + Intergenic
1102231236 12:111263951-111263973 TGAGGCCAGGCACTCTGTATAGG + Intronic
1103767216 12:123288944-123288966 CCAGCCCAGGTGCAGTGTGTGGG - Intergenic
1103941398 12:124503268-124503290 CCAGACCTGTCACTGGGTGTGGG - Intronic
1104715670 12:131014523-131014545 CCAGCCCAGGCACTATGCGAGGG - Intronic
1104967295 12:132514019-132514041 CCAGGCCCTGCCCTGCGTGTTGG + Intronic
1105706339 13:22969712-22969734 CCATGCCAGGCACTGGCTCTTGG - Intergenic
1105858988 13:24393170-24393192 CCATGCCAGGCACTGGCTCTCGG - Intergenic
1105863495 13:24438407-24438429 ACAGGCCAGGGACTGGGGGTTGG + Intronic
1106433954 13:29707809-29707831 TCTGTCCAGGCACTGTGTGCAGG + Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1107647343 13:42508785-42508807 AAAGGCCAGGGAATGTGTGTAGG + Intergenic
1110384316 13:74891098-74891120 CCAGGCACTGCACTGTGTCTAGG + Intergenic
1112744341 13:102509695-102509717 GCAGGCAAGAGACTGTGTGTAGG - Intergenic
1113443497 13:110347641-110347663 CCAGGGCATGCAGTGTGTGGTGG - Intronic
1113956441 13:114102044-114102066 CAAGGCTGGGGACTGTGTGTCGG - Intronic
1114642536 14:24233029-24233051 CCATCCCAGGTACTGTTTGTTGG - Exonic
1114675848 14:24440018-24440040 CCAGGTTAGGCACTGTGAATAGG - Exonic
1117987044 14:61396845-61396867 CCAGGACAGGCTCAGTTTGTTGG + Intronic
1121211689 14:92212061-92212083 CCTGGCCAGGCACTGACTGCAGG + Intergenic
1121220375 14:92280394-92280416 CCAGGCCTGGGACTGTATGATGG - Intergenic
1121250438 14:92495762-92495784 CCAGGCCAGCCTCTGTAAGTTGG + Exonic
1122694726 14:103547071-103547093 GCAGGCCAGGGGCTGTGTGGAGG + Intergenic
1123758586 15:23415819-23415841 CCAGGAGAGCCCCTGTGTGTGGG - Intergenic
1123938044 15:25203445-25203467 GCAGCCCAGGCTCTCTGTGTGGG + Intergenic
1124090946 15:26599395-26599417 GCAGGCCAGGCCCTGAGTTTAGG - Intronic
1125252489 15:37721404-37721426 CCATGCCAGGCTCTGTCTGATGG + Intergenic
1127922956 15:63507689-63507711 CCATGGAAGGCACTGTGTGTTGG + Intronic
1127954524 15:63841697-63841719 CCAGGCCACGCACCTTATGTGGG - Intergenic
1128245743 15:66131511-66131533 CCAGCCCAAGCAGTGTGTGGAGG + Intronic
1128797925 15:70478585-70478607 CCAGGCCAGGCAGGGCGAGTGGG - Intergenic
1129263516 15:74382091-74382113 CCAGGCCCAGCACTGAGTGAGGG + Intergenic
1130679156 15:85981269-85981291 CCAAGGCAGACAGTGTGTGTGGG + Intergenic
1131090183 15:89618618-89618640 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131090752 15:89623174-89623196 ATGTGCCAGGCACTGTGTGTTGG - Intronic
1131512086 15:93055050-93055072 CCGGGACAGGCATTGTGTGTAGG - Intronic
1131563247 15:93462551-93462573 CCACGCCAGGGACTGTGGGGAGG - Intergenic
1132291424 15:100706255-100706277 CTAGGCCAGGCAGTGTCTGAGGG + Intergenic
1132946031 16:2531914-2531936 CCAGGCCAGAGACTGCGTTTGGG + Intergenic
1133194536 16:4159549-4159571 CTGGGCCAAGGACTGTGTGTAGG + Intergenic
1134194991 16:12152917-12152939 CCAGCCCTGCCACTGTGTGCGGG - Intronic
1134862020 16:17568695-17568717 CCAGGCCAGGCTCAGGGTGCTGG - Intergenic
1136145989 16:28317101-28317123 CCTTGCCTGACACTGTGTGTGGG + Intronic
1136552519 16:30989284-30989306 CCAGGTCAGGCCCTGTGGGACGG - Exonic
1136626946 16:31467057-31467079 CAAGGCCAGGTTCTGGGTGTAGG + Exonic
1137527025 16:49245247-49245269 CCAGGCCAGGACCAGTGTCTGGG + Intergenic
1137563980 16:49521938-49521960 CCAGGCCTGGCAGTGTGGGTGGG + Intronic
1138271105 16:55696395-55696417 TCAGGCCCAGCACTGTGTGTTGG - Intronic
1138472547 16:57249601-57249623 CCAGGACAGGAGCTGTGTTTTGG + Intronic
1139433226 16:66922340-66922362 GCAGGCCCGGCCCTCTGTGTGGG + Exonic
1141612123 16:85187729-85187751 CCAAGCCTGTCCCTGTGTGTGGG - Intergenic
1142119706 16:88379881-88379903 CCGGGCCAGTCACTGTGTGAAGG - Intergenic
1142302652 16:89267584-89267606 CCAGGAGAGGGGCTGTGTGTGGG - Intergenic
1142899763 17:3004660-3004682 CCAGGCTAGGAACTGAGGGTGGG - Intronic
1143764700 17:9129923-9129945 CCAGGCCAGTGATGGTGTGTAGG + Intronic
1144864557 17:18326796-18326818 CCAGGCCCAGCACTGCTTGTTGG + Intergenic
1144948619 17:18982341-18982363 CCAGGCCAGGCCCCGTGGGGTGG - Intronic
1145246484 17:21273135-21273157 CCAGGCGGGGCAGTGGGTGTGGG - Intergenic
1145254563 17:21315570-21315592 CCAGCCCAGGCAAAGTGTGCAGG - Intergenic
1145310305 17:21697654-21697676 CCAGGCCCTGCCCTGGGTGTAGG - Intronic
1145322033 17:21772394-21772416 CCAGCCCAGGCAAAGTGTGCAGG + Intergenic
1147263616 17:39222780-39222802 GCAGGCCAGGCCCTGTCTCTGGG - Intronic
1148697156 17:49567547-49567569 CCAGGCCCGGCACTCTCTGGAGG - Intergenic
1151296374 17:73189489-73189511 CCGGGCCAGGCACTGTGCCGGGG - Intergenic
1151388567 17:73770524-73770546 CCCGGCCAGGCAGTGGATGTGGG - Intergenic
1151849374 17:76681348-76681370 CCAGGGCTGGCAGTGTGTCTTGG - Intronic
1151943413 17:77306490-77306512 CCAGGCCAAGGCCTGTGTGTGGG + Intronic
1152123862 17:78434879-78434901 TGGGGCCAGGCACTCTGTGTGGG + Intronic
1152744752 17:82033564-82033586 CATGGCCAGGCCCTGTGGGTAGG - Exonic
1152751031 17:82062470-82062492 CCAGGCCAGGCTCAGTGTGCGGG + Intronic
1153220200 18:2854306-2854328 GCAGCACAGGCTCTGTGTGTTGG - Intronic
1154105336 18:11517994-11518016 GCAGCCCAGGCACAGTGTTTTGG + Intergenic
1154956412 18:21261188-21261210 TCAAGCCAGCAACTGTGTGTTGG - Intronic
1157286937 18:46383202-46383224 CCAGGGGAGGCAGTGGGTGTTGG + Intronic
1160038240 18:75320791-75320813 CAATGCCAGGCACTGTGAATTGG - Intergenic
1160832358 19:1109808-1109830 CCAGGCCTGGGACTGTGGGCTGG + Intronic
1161669181 19:5595245-5595267 CCAGCCCAGGCACTGGCTCTCGG + Intronic
1162821315 19:13225210-13225232 CCAAGCCAGGGATTGGGTGTGGG - Intronic
1162986989 19:14277312-14277334 CCGGGCCAGGCCCTGTGCCTGGG + Intergenic
1164483664 19:28636442-28636464 TCAGGGCAGGCACTTTCTGTGGG - Intergenic
1164905891 19:31967720-31967742 CCAGGCAAGGCCCTTTGTCTCGG + Intergenic
1165299481 19:34959719-34959741 CCTGGCCAGGCACAGTATGGCGG - Intronic
1165344742 19:35237761-35237783 GCAGGCAAGCAACTGTGTGTAGG - Intergenic
1166214997 19:41329008-41329030 CCAGGACAATCACTGGGTGTGGG + Intronic
1166638102 19:44469696-44469718 CCCTGGTAGGCACTGTGTGTGGG + Intergenic
925375105 2:3378585-3378607 CCAGGGCAGGCACTTTGAGCAGG - Intergenic
927276427 2:21266219-21266241 CCAGACCAGGAACTGTGTCCTGG + Intergenic
927790101 2:26002975-26002997 CCAGGCCATGAACTGGGTGAAGG - Intergenic
928300027 2:30116852-30116874 CAGGGCCAGGGACTGTGTCTGGG - Intergenic
929596700 2:43180568-43180590 ACAGGCCAAGCTCTTTGTGTGGG + Intergenic
929773808 2:44915267-44915289 ACAAGCCAGGCCCTGTGTGTTGG - Intergenic
931793999 2:65692201-65692223 CCAGACCAGGCACTATGAGGGGG - Intergenic
932161792 2:69466829-69466851 CCGTGCCTGGCCCTGTGTGTAGG - Intronic
932188239 2:69716929-69716951 ACTGGCCAAGCACTGTGTGGAGG + Intronic
932708476 2:74045657-74045679 TCAGGCCTGGGGCTGTGTGTGGG + Intronic
934771388 2:96909851-96909873 CCAGGGCAGGCCCAGTGTTTTGG - Intronic
937061733 2:118985060-118985082 CTGGGCCAGGCACTGTGCCTGGG + Intronic
938228381 2:129636954-129636976 GCAGGCTGTGCACTGTGTGTCGG - Intergenic
938579334 2:132632160-132632182 CCAGGCCTGGCAGTGGGGGTGGG + Intronic
938581305 2:132648888-132648910 CCAGGCCAGGCACCCTGAGGAGG + Intronic
940883375 2:158968725-158968747 CGAGGCCCGGCCCTGGGTGTGGG + Exonic
940943736 2:159592955-159592977 CCAGGCAAGGAACTCAGTGTTGG - Intronic
941937576 2:170997356-170997378 CCAGGCCAAACTGTGTGTGTGGG + Intronic
946384567 2:219374753-219374775 TCAGGCCAGTCACTTTGTGATGG + Intronic
946858805 2:223980192-223980214 TCCAGCCAGGCAGTGTGTGTGGG - Intronic
947932908 2:233978758-233978780 ACAGTCCAGTCACTGTGTGAAGG - Intronic
947983594 2:234429887-234429909 CTAGGCCATGCACTGTGCTTTGG + Intergenic
948698903 2:239748423-239748445 CCTGTCCAGGCACGGTGTGGGGG + Intergenic
948836394 2:240628122-240628144 GCTGGGCAGGCACTGTGCGTTGG - Intronic
948869741 2:240791978-240792000 CCAGGCCATGTATTGTGTCTGGG + Intronic
1168998828 20:2151939-2151961 GCAGGCCAGGCACAGGGTGTGGG - Intronic
1170847885 20:19977254-19977276 GAAGGCCAGGCACTGTGGGCTGG - Intronic
1170879926 20:20287970-20287992 ATATGCCAGGCACTGTGTGAGGG - Intronic
1171382680 20:24745499-24745521 GCATGCCAGGCCCTGTGGGTGGG + Intergenic
1172579381 20:36034848-36034870 CCATACCAAGCACTGTGTGGGGG + Intergenic
1172663851 20:36585852-36585874 CCAGGCCCGGGACTCTGTGCTGG + Intronic
1173034245 20:39393623-39393645 CCAGACCAGTCACTGAATGTGGG - Intergenic
1173401688 20:42731560-42731582 CCAGGCCCAGCACTGTGTGAAGG + Intronic
1174420026 20:50393497-50393519 CCAGGACAGGCAGTGTATGGAGG - Intergenic
1175261674 20:57678479-57678501 CCAGGCCTGGCACTGGGGGAGGG + Intronic
1175727757 20:61331409-61331431 CCAGGCCAGCCAGTGGGAGTTGG - Intronic
1175855318 20:62117949-62117971 CCAGGTCTGGCACTGAGTGGTGG + Intergenic
1176075325 20:63245606-63245628 CAAGGCCAGGCTCTGGGGGTTGG - Intronic
1176168383 20:63686216-63686238 CCCGGCCAGGCGCTGCGTGGAGG - Intronic
1178095000 21:29205196-29205218 ACAGGCAAGACACTGTGTGCAGG - Intronic
1178102448 21:29284343-29284365 CCTGGCCAGGCAAGGTGTGATGG + Intronic
1178244531 21:30937830-30937852 CAAGGCCAGACACTGTGTGGAGG - Intergenic
1179507654 21:41852486-41852508 CCAGGCCAGGCACCTGGTTTTGG + Intronic
1179997908 21:44982334-44982356 CCACACCAGGCTCTGTGTGCAGG - Intergenic
1180675340 22:17582463-17582485 CCAGGCCAGTCCCTGAGTGAAGG - Intronic
1180818810 22:18810804-18810826 CCAGGCCAGGTTCTGTGGGCTGG - Intergenic
1180935925 22:19625461-19625483 TCAGGCCAGGCTCTGGGGGTGGG - Intergenic
1181205034 22:21245259-21245281 CCAGGCCAGGTTCTGTGGGCTGG - Intergenic
1183040682 22:35175581-35175603 CCAGGCCCTGCACTAGGTGTGGG - Intergenic
1183333631 22:37234551-37234573 CCAGGTCAGGGCCTGTGTGGGGG - Intronic
1183493298 22:38128019-38128041 CCAGGCCTGAGACTGTGTGCAGG + Intronic
1184249155 22:43250431-43250453 TCAGGCCAGGCACTGCTTCTTGG + Intronic
1184401840 22:44278997-44279019 CCAGGGCAGGCACTGAGACTAGG + Intronic
1184827237 22:46960657-46960679 CCAGGCCAGGCGCGGCGTGGTGG + Intronic
1184865630 22:47200467-47200489 CAAGGCCAGGAAATGTGTGGAGG + Intergenic
1184982233 22:48102793-48102815 CTAGGCCAGGCACAGAGGGTCGG - Intergenic
1185334584 22:50265899-50265921 CCTGGCCAGGCACTGCTTGCTGG + Intronic
1185334602 22:50265946-50265968 CCTGGCCAGGCACTGCTTGCTGG + Intronic
1185334619 22:50265991-50266013 CCTGGCCAGGCACTGCTTGCTGG + Intronic
1203221891 22_KI270731v1_random:50156-50178 CCAGGCCAGGTTCTGTGGGCTGG + Intergenic
1203268938 22_KI270734v1_random:36657-36679 CCAGGCCAGGTTCTGTGGGCTGG - Intergenic
950738758 3:15032822-15032844 CCAGGCCGGGAACTGTGCCTAGG + Intronic
953572618 3:44083168-44083190 CAAGGCCAGGCACAGGGTGGAGG + Intergenic
955102705 3:55867309-55867331 CTGTGCTAGGCACTGTGTGTGGG - Intronic
955114363 3:55982671-55982693 ATAGGCTAGGCACTGTGTGCTGG - Intronic
956750002 3:72337728-72337750 CCAGGACAGGATCTGAGTGTGGG + Intergenic
958529645 3:95309887-95309909 CCAGGCAATGCACTGTCTGAGGG + Intergenic
959389806 3:105759681-105759703 CCAGAGCAGGCACTGTGAGCAGG + Intronic
960503310 3:118463976-118463998 ACAGGGCATTCACTGTGTGTCGG + Intergenic
960997542 3:123349942-123349964 CCAGGCCAGGCTGTGGGCGTGGG - Intronic
961555258 3:127692707-127692729 CCAGGCTAGCCACCGTGGGTTGG - Intronic
961673342 3:128550189-128550211 CTAGGCCAGTCACTGTGGGATGG - Intergenic
962908928 3:139830090-139830112 CCAGGCCAAGCACTGTAGCTAGG + Intergenic
962935512 3:140076947-140076969 CCCGCCCAGGCACTGTGCTTTGG + Intronic
963466496 3:145688718-145688740 CCAGGGGATGCACTGTCTGTGGG - Intergenic
964003837 3:151807477-151807499 CCCGGCCAGGGTCTGTGGGTTGG - Intergenic
964275157 3:155001564-155001586 ACAGGCAAGGAACTGTGTGGGGG - Intergenic
966871573 3:184293331-184293353 CCAGGCCTGACACTGAGTGTGGG + Intronic
967215604 3:187207396-187207418 CAAGCCCAGGCACTTTCTGTGGG - Intergenic
967615991 3:191567271-191567293 CCATGCCAGGCACTGTTAGAAGG + Intergenic
968447037 4:657352-657374 CCAGCCCAGGAACTGTGTCAGGG - Exonic
968625331 4:1624311-1624333 CCAGGTCAGGCGCTGTGTCAAGG + Intronic
968885598 4:3329460-3329482 CCAGGCCAGGCAGTGGGAGAAGG + Intronic
969482582 4:7454598-7454620 TGGGGTCAGGCACTGTGTGTTGG + Intronic
969482691 4:7455139-7455161 TGCGGTCAGGCACTGTGTGTTGG + Intronic
969482716 4:7455251-7455273 TGGGGTCAGGCACTGTGTGTTGG + Intronic
971342351 4:25782129-25782151 CGAGGACAGGGACTGTGTCTGGG + Intronic
973933157 4:55814097-55814119 CAATGACAGGCTCTGTGTGTTGG - Intergenic
978916041 4:114127201-114127223 ACAGGCAAGGAACTGTGAGTTGG + Intergenic
980083929 4:128372152-128372174 CCATGCCAGGCACTGCGTTATGG - Intergenic
980243116 4:130202363-130202385 TCAGGCCAGGCACGGTCTGAAGG + Intergenic
981232942 4:142379809-142379831 CCACGTCAGGCACTGTGTAAGGG + Intronic
981539001 4:145828766-145828788 CCAGGCCAGGCATGGGATGTGGG + Intronic
984556121 4:181216111-181216133 CCAGGCCAGGCACAGCGTGTTGG - Intergenic
985550535 5:531327-531349 GCAGGCCAGGCAGTGTCTGCTGG - Intergenic
986605582 5:9520224-9520246 CCAGGCCAGGCACTGTTGTCAGG + Intronic
995015674 5:107306188-107306210 CCAGTCCAGTCACTGGGTGTGGG - Intergenic
996347545 5:122503032-122503054 CCAGGCCAGGTTCTGAGTTTGGG - Intergenic
996434693 5:123421921-123421943 AAAGGCCTGGCACTGTGTGAGGG - Intronic
997211076 5:132077120-132077142 CCAGGCCTGGCGCTGTCTGCAGG - Intergenic
997459393 5:134041867-134041889 CCAGGCCAGCCAGGGAGTGTGGG - Intergenic
997929947 5:138064292-138064314 CCAGGCCAGGCACTGTGTTGAGG + Intergenic
997979858 5:138462298-138462320 GCAAGGCAGGTACTGTGTGTTGG + Intergenic
998081324 5:139277288-139277310 CCAGGCCAGGCACGGTGCAGTGG - Intronic
1001300809 5:170532341-170532363 CCAGGCCAGGCAGTTTCTGCTGG + Intronic
1001600710 5:172926439-172926461 CCAGGCCTGGCCCTGGTTGTGGG - Intronic
1002136616 5:177111806-177111828 CACGGTCAGGCACAGTGTGTTGG - Intergenic
1002526867 5:179819981-179820003 CCAGGCAAGGTCCTGTGAGTAGG - Intronic
1002581851 5:180213418-180213440 CCAGCCCAGGCTCAGTGGGTTGG - Intergenic
1002921303 6:1575272-1575294 CCAGGGCAGGCACTGGGGGAAGG - Intergenic
1003003593 6:2360214-2360236 CCAAGGCAGGGCCTGTGTGTCGG + Intergenic
1003108303 6:3231826-3231848 CCCGGCCTGGCTCTGTGTCTAGG - Intronic
1003350953 6:5317491-5317513 CCAGGCCAGGCTGCGTGTGGTGG + Intronic
1007324897 6:41052583-41052605 ACAGGCCAGGCAGTGGGTTTAGG - Intronic
1007369148 6:41414831-41414853 AGAGGCCAGGAACTGTCTGTAGG - Intergenic
1007448983 6:41928883-41928905 CAATGCCAGGCACTGAGTTTGGG - Intronic
1007578415 6:42940641-42940663 CCAGGCTAGGCCCAGTGGGTAGG + Intergenic
1008054887 6:46936090-46936112 CCACCCTAGGCACAGTGTGTCGG + Intronic
1011184543 6:84659680-84659702 CCACGCAAGTCACTGTGTGCTGG - Intergenic
1013588953 6:111604363-111604385 CTGGACCAGTCACTGTGTGTGGG - Intronic
1015032968 6:128618089-128618111 CCTGACAAGGAACTGTGTGTAGG + Intergenic
1016462819 6:144296134-144296156 CCAGTCCAGGCCCTGGGAGTTGG - Intronic
1016874101 6:148847778-148847800 CCAGAACAGGCTCTCTGTGTTGG - Intronic
1017028748 6:150202632-150202654 CCAGGCCAGGCTGTGTGGGAGGG - Intronic
1017052527 6:150407200-150407222 CCAGCTCAAGCACTGTGTGAAGG - Intergenic
1017852134 6:158314060-158314082 CCAGGACAGGCACAGGATGTTGG - Exonic
1018206809 6:161444134-161444156 CCAGGCCAGGCCCAGCGGGTGGG + Intronic
1018726360 6:166616051-166616073 CCCTGCCACCCACTGTGTGTGGG + Intronic
1019151082 6:170006317-170006339 CCAGGCAGGGCTCTGTGTGCTGG - Intergenic
1019659592 7:2216670-2216692 CCAGGGTAGGCTGTGTGTGTAGG + Intronic
1019736391 7:2651808-2651830 CCAGGCAAGGGGCAGTGTGTGGG + Intronic
1021978925 7:26035910-26035932 CCATGCCAGGCACTGTTTCCTGG - Intergenic
1022466714 7:30656961-30656983 GCAGGCAAGGGAGTGTGTGTCGG + Intronic
1022473192 7:30694281-30694303 CCATGCCAGGCACTGAGAGGCGG - Intronic
1023004586 7:35849524-35849546 ACAGGCCACGGACTGTGGGTTGG + Intronic
1023042529 7:36184501-36184523 CCAGCCCTGGGACTGTGTGAGGG + Intronic
1023367296 7:39476519-39476541 ACAGGCCAGGCACTGTGTAAAGG + Intronic
1024350612 7:48359182-48359204 CAACGCCAGGCACTGTGAATGGG + Intronic
1024604754 7:51014214-51014236 TCAGGCGAGGCACTGCGAGTTGG + Intergenic
1024655842 7:51450836-51450858 GGAGGCCAGGCCTTGTGTGTGGG + Intergenic
1024972020 7:55079226-55079248 AGAGGCCAGGCACGGGGTGTGGG + Intronic
1026570302 7:71523465-71523487 CTTGGCCAGGCACAGTGAGTGGG + Intronic
1026869367 7:73841279-73841301 CCAGGCTAAGCTGTGTGTGTTGG + Intronic
1027613765 7:80395027-80395049 AGAGGCCAAGCAATGTGTGTTGG + Intronic
1028024569 7:85821229-85821251 TCAGGCCAGGAAGTGTGTGAAGG + Intergenic
1029381027 7:100214680-100214702 CCAGGCCAGGCCATGTGTCCTGG + Intronic
1029400404 7:100341627-100341649 CCAGGCCAGACCCTGTGTCCTGG + Intronic
1029692141 7:102189602-102189624 CCAGGCACGGCAAAGTGTGTAGG - Intronic
1032815600 7:135470486-135470508 CCTGGCCAGGCACAGTGAGCTGG + Intronic
1033032944 7:137845254-137845276 CCAGGCCAGGCGATGTCTATGGG + Intronic
1033137311 7:138796217-138796239 CCAGGCCAGGCTCTCGGTGTGGG - Intronic
1034630138 7:152524308-152524330 CGAGCCCAGGCTCTGTGTGTAGG - Intergenic
1034695277 7:153047947-153047969 CCAGGCCTGGCCCTGCGTGTAGG + Intergenic
1034838285 7:154372422-154372444 TCAGCACAGGCACTGCGTGTTGG - Intronic
1035260162 7:157656096-157656118 ACACACCAGGGACTGTGTGTGGG + Intronic
1035644696 8:1210161-1210183 CCAGGCCAGGCTCTGTGGAGTGG + Intergenic
1037759627 8:21733321-21733343 GCAGGCCAGGGCCTGGGTGTGGG - Intronic
1037973517 8:23192177-23192199 AGAGGCCAGGCAGTGTGGGTGGG - Intronic
1037992159 8:23328661-23328683 CCAGGCCAGGCACTCAGTCTGGG + Intronic
1038033242 8:23663114-23663136 CCAGGCAAGGCCCTGGGTGCTGG - Intergenic
1040941826 8:52842158-52842180 CCAGGCCAGGCACAGCGTGGTGG - Intergenic
1041283246 8:56232813-56232835 CCATGCCATGCACTTTCTGTGGG + Intergenic
1047040095 8:120983925-120983947 GCAGGCCAGGCACTAGGTCTTGG - Intergenic
1047156523 8:122325524-122325546 CCAGCCCTGGTACTGTGTGCAGG - Intergenic
1048493092 8:134912808-134912830 AGAGGCCAAGCCCTGTGTGTAGG - Intergenic
1049078565 8:140421638-140421660 CTATGCCAGGCACTGTGCGAGGG + Intronic
1049204943 8:141359292-141359314 CCAGGCCAGGGGCTGTTTGAAGG - Intronic
1049879919 8:145054771-145054793 CCAGGCCAGGCTCTGTTCTTAGG + Exonic
1050654359 9:7809972-7809994 CCATGCCAGGCTCTGAGTGCAGG - Intronic
1050991189 9:12154465-12154487 CAATGACAGGCACTGTGTGGTGG + Intergenic
1051186642 9:14467317-14467339 CCTGGCCAGACCCTGTGTGCTGG - Intergenic
1052857009 9:33413685-33413707 CAAAGCCAGGCAGGGTGTGTTGG - Intergenic
1055094512 9:72398019-72398041 CCAAGCTATGCACTATGTGTTGG + Intergenic
1055343289 9:75308528-75308550 CGAGGCCAGGCAGTGTGGATGGG - Intergenic
1055742766 9:79407918-79407940 CCACGGCAGGCACTGGGTGATGG - Intergenic
1056532344 9:87498316-87498338 CCCGACCAGGCGCTTTGTGTCGG + Intronic
1056763070 9:89428324-89428346 CAGGGCCAGGGACTGTGTTTGGG - Intronic
1057282624 9:93723683-93723705 CCAGGCCAGGATCAGTGTGTTGG + Intergenic
1059060367 9:111029766-111029788 TCAGGCCAGGCACGGTGGCTTGG + Intronic
1059451046 9:114371731-114371753 CCAGGCTAGGCATGGTGGGTAGG - Intronic
1059472009 9:114512390-114512412 GTGTGCCAGGCACTGTGTGTGGG + Intergenic
1061083837 9:128387743-128387765 CCAGGCAAGGCTCTGGGGGTGGG + Intronic
1061671009 9:132188192-132188214 CCAGGAGAGGCCCTGGGTGTGGG - Intronic
1062308047 9:135920667-135920689 CCAGGCCTGGCACTGTCTGCTGG + Intergenic
1062479075 9:136743153-136743175 CCAGGCCGGGCACTGAGGGCAGG - Intronic
1186713900 X:12230103-12230125 ACAGGCCAGGGACAGTCTGTGGG - Intronic
1189559891 X:42181671-42181693 CCTAGCCAGTCACTGTGTGCTGG - Intergenic
1192459067 X:71301889-71301911 CCTGGCCAGGGGCTCTGTGTGGG + Intronic
1193116400 X:77779686-77779708 CCAGGCATGGCACTGTGTTAGGG - Intronic
1198520303 X:137445730-137445752 CCAGACCTGGCACTGTGTGCTGG - Intergenic
1198675512 X:139126518-139126540 CCAGGCCATGCCCTGTGTTCTGG - Intronic
1199753361 X:150842280-150842302 CCAGGACAGACACTGGCTGTTGG - Intronic
1200327776 X:155260575-155260597 CCAGGCCAGGCACTGTTTTGTGG - Exonic