ID: 907430279

View in Genome Browser
Species Human (GRCh38)
Location 1:54407091-54407113
Sequence TACTTTGGAAAACCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907430275_907430279 21 Left 907430275 1:54407047-54407069 CCGGCGCCGAGGCGCGCGGCTGC No data
Right 907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 175
907430277_907430279 -3 Left 907430277 1:54407071-54407093 CCTTTACTAGATCATTAAAATAC 0: 1
1: 0
2: 1
3: 23
4: 220
Right 907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 175
907430276_907430279 15 Left 907430276 1:54407053-54407075 CCGAGGCGCGCGGCTGCTCCTTT 0: 1
1: 0
2: 0
3: 77
4: 88
Right 907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907430279 Original CRISPR TACTTTGGAAAACCCCAAAG TGG Intronic
906309144 1:44740521-44740543 GAGTTAGGAAAACCCCAAAAGGG + Intronic
907050846 1:51329354-51329376 TCCTTTGGAAAACACAGAAGTGG - Intronic
907430279 1:54407091-54407113 TACTTTGGAAAACCCCAAAGTGG + Intronic
911397678 1:97332755-97332777 TACATTGAAAAACACAAAAGAGG + Intronic
913252408 1:116922805-116922827 TACTTGGGAAAACCTCAAGAGGG - Intronic
915019675 1:152767131-152767153 TACCATGGAAACCCACAAAGGGG + Intronic
915868844 1:159535908-159535930 CAGTTAGGAAAACCACAAAGAGG + Exonic
916940779 1:169675513-169675535 TGCTTTGCATAACCCAAAAGGGG + Intronic
917647115 1:177040228-177040250 GACTTCAGAAAACCCCCAAGAGG - Intronic
918372961 1:183880333-183880355 AACTTTGGAAAAACCCATACAGG - Intronic
920826723 1:209429799-209429821 TCCTTGAGAAAACACCAAAGTGG - Intergenic
922307324 1:224355823-224355845 TACTTTCCAAGACCCCCAAGTGG - Intergenic
923288527 1:232521168-232521190 TATGTTATAAAACCCCAAAGAGG - Intronic
1063793186 10:9478536-9478558 TACTGAGGAAAACTCCAAAAAGG + Intergenic
1064781886 10:18849829-18849851 TTATGTGGAAAAGCCCAAAGAGG - Intergenic
1066679738 10:37926051-37926073 TACTATGGAAAACCGCATGGAGG + Intergenic
1067655144 10:48186229-48186251 TACTTGGGAAAATCCCCAAATGG + Intronic
1068132281 10:52909554-52909576 TATTTTGTCCAACCCCAAAGAGG - Intergenic
1068274642 10:54777847-54777869 TACTTTGGAAAACTCTTAAGAGG - Intronic
1069954230 10:72040123-72040145 TAGTTTGGAAAAGTCCAGAGAGG + Intergenic
1071709824 10:88039166-88039188 CACTTTGGGAGGCCCCAAAGCGG - Intergenic
1077427077 11:2486112-2486134 TACTGTGGAAAACGGCATAGTGG - Intronic
1077816013 11:5685996-5686018 TACTTTGGAAAAGACAACAGCGG - Intronic
1078604267 11:12761325-12761347 TTCTTTGGAACTTCCCAAAGTGG + Intronic
1079415506 11:20232103-20232125 TACTTTGGAGAGCATCAAAGAGG - Intergenic
1082258341 11:50057253-50057275 TACTAGGTAAAAACCCAAAGGGG + Intergenic
1082897144 11:58204043-58204065 TACTCAGGAAAAGCACAAAGAGG + Exonic
1089307167 11:117533906-117533928 TGCCTGGGAAATCCCCAAAGAGG - Intronic
1090420957 11:126574607-126574629 TAGATTGGATAACCCCAAAAGGG - Intronic
1091196666 11:133737417-133737439 TACCTTGGAAAAACCCAATCAGG - Intergenic
1091657766 12:2358120-2358142 TCCTTTGGAAAACCCCTCTGAGG - Intronic
1096276162 12:50210120-50210142 TTCTTTTGAAAAACCAAAAGGGG + Intronic
1100811273 12:98340811-98340833 TAATTTAGAAAACAGCAAAGTGG - Intergenic
1101682534 12:106983806-106983828 TACTTTGCAATTCCCCAAAGGGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1106672722 13:31923740-31923762 TGCTTTGGAAGACCCCAAACTGG + Intergenic
1107871372 13:44749415-44749437 TACTTTGGAAACCCACCAAAGGG - Intergenic
1108820207 13:54340057-54340079 TTCTTTGCAAAGCCCAAAAGTGG - Intergenic
1109296830 13:60543288-60543310 TACTTCAGAAAACCCCAAGCAGG - Intronic
1109564230 13:64090284-64090306 TATTTAGGTACACCCCAAAGTGG - Intergenic
1110098040 13:71556202-71556224 TTCTTTGGAAAACATAAAAGGGG - Intronic
1110497567 13:76187413-76187435 TAATTTTGAAAACCACAAAGGGG + Intergenic
1115651486 14:35405152-35405174 CAGGTTGGCAAACCCCAAAGAGG - Intergenic
1116175248 14:41461313-41461335 AACTTTGGAAAAGTTCAAAGAGG + Intergenic
1116575000 14:46562951-46562973 TACTTTTAAGAACCCCAAACTGG + Intergenic
1117071361 14:52059783-52059805 TAATCTGGAAAACCTCAAACTGG + Intronic
1117850823 14:59967374-59967396 TACTTTGGTATAATCCAAAGAGG - Intronic
1120726679 14:87949977-87949999 GATTTTGGAAATCCTCAAAGAGG - Intronic
1121821060 14:96966474-96966496 TAATGTGGACAACCCCGAAGTGG + Intergenic
1123540501 15:21285022-21285044 TGCTTTGGGAATCCCCACAGAGG + Intergenic
1124353549 15:28978168-28978190 TCCTTTGGCAAACGCCCAAGAGG - Intronic
1124955356 15:34356638-34356660 TTCTTTGGAAGACCCCAGTGTGG - Exonic
1125550923 15:40544014-40544036 TGGTATGGAAAACCCCAAACAGG - Intronic
1127764929 15:62175912-62175934 TTATTTGGAAAAACACAAAGTGG + Intergenic
1128379723 15:67103691-67103713 TGCTTAGGAAAACCGCACAGGGG - Intronic
1128959317 15:71984760-71984782 TACTTTTAAAAATCCCAAATTGG - Intronic
1128991043 15:72260567-72260589 TACCATGAAGAACCCCAAAGTGG - Exonic
1132086784 15:98914877-98914899 TATTTTTGGAAACCCTAAAGTGG + Intronic
1202948815 15_KI270727v1_random:12164-12186 TGCTTTGGGAATCCCCACAGAGG + Intergenic
1132537785 16:491877-491899 TGCTGTGGAAAGCTCCAAAGTGG - Intronic
1133959962 16:10484841-10484863 TACTTTGCAACAACCCAATGAGG + Intergenic
1134782243 16:16908782-16908804 TGCTGTGTAAATCCCCAAAGAGG + Intergenic
1136182365 16:28562507-28562529 TACTTGGGAAAACACTGAAGAGG - Intronic
1138444299 16:57053828-57053850 AACTTTTGAAAACCCAAATGAGG - Intronic
1139642198 16:68299984-68300006 TACTTAGGAAATCCTAAAAGAGG + Exonic
1140652539 16:77104697-77104719 GACCTTGAAAATCCCCAAAGAGG + Intergenic
1140734599 16:77887180-77887202 GATTTTGGTAAATCCCAAAGGGG + Intronic
1142639101 17:1275214-1275236 TCCTTAGGAAAACTCCCAAGAGG + Intergenic
1144508446 17:15854719-15854741 TGCTTTGGAAAACCTCACAATGG + Intergenic
1145172570 17:20672360-20672382 TGCTTTGGAAAACCTCACAATGG + Intergenic
1148002164 17:44395810-44395832 TAGTTAGGAAAATGCCAAAGTGG + Intronic
1150909009 17:69368923-69368945 TGCTTTTGAAATCCGCAAAGGGG + Intergenic
1150985093 17:70186945-70186967 TATTTTGGAAAAACTCTAAGAGG - Intergenic
1152246455 17:79187195-79187217 TCCTTTGGAAATTCCCAAGGTGG + Intronic
1155830627 18:30511980-30512002 TACCTTTAAAAAACCCAAAGAGG + Intergenic
1156358026 18:36359806-36359828 TACTTCGAAACAACCCAAAGAGG - Intronic
1161579811 19:5074677-5074699 TACTTTGCAAAACCTCACCGTGG + Intronic
1163846711 19:19642333-19642355 TAGACTGGAAATCCCCAAAGTGG - Intronic
1164069034 19:21749203-21749225 TACTTTGGTGAAACACAAAGAGG - Intronic
927362302 2:22250109-22250131 TTCTTTGGAAAACACCATAGCGG - Intergenic
928355079 2:30605062-30605084 TACTTTGGAAAACACTACAATGG - Intronic
931531969 2:63225449-63225471 TACTCTGGAAAAATCCTAAGAGG + Intronic
932293745 2:70607358-70607380 AGCTATTGAAAACCCCAAAGTGG + Intergenic
933694195 2:85204371-85204393 TACTATGGAATACCACACAGTGG - Intronic
933740336 2:85528914-85528936 TACTTTTTAAAAACCCAAAAGGG + Intergenic
938777943 2:134558626-134558648 TACCTTGGAAATGCACAAAGAGG + Intronic
939148216 2:138441949-138441971 TTCATTGCAAAACCCCAAGGAGG + Intergenic
940990096 2:160087918-160087940 TCCTTTGGAATGGCCCAAAGTGG + Intergenic
941445465 2:165593373-165593395 TACTTTGTGAAGCCCCAAATTGG - Intronic
941530307 2:166661939-166661961 AAATTTGGAAAGCCCCAATGTGG + Intergenic
942295764 2:174515573-174515595 AAGCTTGGAAAACCCCAAAGAGG - Intergenic
945789335 2:214285184-214285206 TACTATTGAAAACCACAATGAGG - Intronic
946360326 2:219215870-219215892 TACTTTAAAAAACACCAAGGTGG + Intronic
946582516 2:221145105-221145127 TATTTTGGAAAAGTCCAAAATGG + Intergenic
948631355 2:239304817-239304839 AACTTTAGAAAGCCCCCAAGGGG - Intronic
1168860152 20:1040239-1040261 AACTTTGGACAACCCCACTGAGG - Intergenic
1170281192 20:14650883-14650905 CAGTTTGAAAAACCCCAAACAGG + Intronic
1171318169 20:24214264-24214286 TCCTTTATAAAACCCCAAAGAGG + Intergenic
1172340812 20:34155962-34155984 CACAGTGCAAAACCCCAAAGAGG + Intergenic
1173071376 20:39770675-39770697 TAAATTGGAATACCCAAAAGAGG - Intergenic
1174440311 20:50546338-50546360 TTCTTTGGAAAGCCACACAGAGG + Intronic
1174537898 20:51266953-51266975 TCCTTTGCAAATCCCCAAATTGG - Intergenic
1179045322 21:37839165-37839187 TGGTTTGAAAAACCCCAAACTGG - Intronic
949139580 3:616103-616125 GTCTTTGCAAAAACCCAAAGAGG + Intergenic
949208245 3:1466592-1466614 TACTCTGGAAAACCCCAGTCTGG - Intergenic
953865823 3:46582525-46582547 TACTTTGGAAAATGCAAAAAGGG - Intronic
954869451 3:53756615-53756637 TGCTTTTGAAAACCCTACAGAGG - Intronic
960010042 3:112823856-112823878 CACTTTTGAAGAGCCCAAAGAGG + Intronic
960010186 3:112825311-112825333 CACTTTTGAAGAGCCCAAAGAGG + Intronic
960428037 3:117533141-117533163 TACTTTGTAAGACCCCCCAGTGG + Intergenic
960900739 3:122551779-122551801 TACTTAGGAAAAGGCCAACGAGG + Intronic
962381952 3:134905235-134905257 CACTTTGGATAGCTCCAAAGAGG - Intronic
963297602 3:143563112-143563134 TGTTTTGAAAAACCACAAAGAGG + Intronic
963846569 3:150164736-150164758 TCCTTTGGAAAACACAAAATGGG - Intergenic
965545820 3:169915369-169915391 TACTTTGGAATCCCCAAAGGAGG - Exonic
967659296 3:192085669-192085691 TACATTGGAAGACCCCAGAATGG - Intergenic
971017219 4:22500818-22500840 TACTTTGGTCTTCCCCAAAGTGG - Intronic
974030615 4:56773105-56773127 TACTTTTAAAAACCCTGAAGCGG + Intergenic
975178753 4:71318639-71318661 TACTTTAAAACACACCAAAGGGG - Intronic
976612162 4:87041360-87041382 TATTTTGGTAAGCCCCAAAAAGG + Intronic
977135742 4:93301632-93301654 TACTTTGATAAACCACAAAATGG - Intronic
980400283 4:132275683-132275705 TACATTGTAATACCCTAAAGGGG + Intergenic
981453001 4:144920870-144920892 CTCTCTGGAAACCCCCAAAGAGG - Intergenic
984078756 4:175216077-175216099 CACTTTGGAAAACCTGAAGGTGG + Intergenic
984904021 4:184610333-184610355 CACTTTGTAAAAACCCAATGGGG + Intergenic
986949574 5:13066478-13066500 TACTTTGGAAAGACCAAAAGTGG + Intergenic
988325911 5:29767305-29767327 TAGTTTGGAAAACCACATATTGG + Intergenic
989624236 5:43414329-43414351 GCCTTTGTAAAACCCCAAAAGGG + Intergenic
989733442 5:44674655-44674677 CACTCTGGAAAACTCCCAAGAGG + Intergenic
989810639 5:45668775-45668797 TAATTTGGAAAATAGCAAAGTGG - Intronic
990356401 5:54970954-54970976 TACTTTGGAAAACGTAAAATTGG + Intergenic
992658168 5:78931018-78931040 ATCTTTGTATAACCCCAAAGCGG + Intronic
993618106 5:90137206-90137228 AACTTTGCAACACCCCAGAGCGG + Intergenic
994221282 5:97198124-97198146 TGGTTGGGAAAACCTCAAAGTGG + Intergenic
995477077 5:112559273-112559295 TACTTTGGAAAATAGAAAAGTGG - Intergenic
999668720 5:153939542-153939564 TTCTGTGGAAAATTCCAAAGTGG + Intergenic
1000006960 5:157194615-157194637 CACTTTGGGAAACACCAAATTGG - Intronic
1000153029 5:158521721-158521743 CACTTTGGAAAACACAAAGGGGG - Intergenic
1000801094 5:165727289-165727311 TATTTTGAAAAAGCCCCAAGGGG - Intergenic
1002622424 5:180497599-180497621 TACTTTGGAAAAGTCCTAATAGG + Intronic
1003302725 6:4898984-4899006 TACTTTGAAGAAATCCAAAGTGG - Intronic
1004066029 6:12245453-12245475 GACTTTGGAAATCCCTAAAGTGG + Intergenic
1007434822 6:41802537-41802559 GACTTTGGGAGACCCCAAGGTGG - Intronic
1007583219 6:42971983-42972005 TAATCTGGAAAACCTCGAAGAGG + Intronic
1008067675 6:47067348-47067370 TAATTTTAAAAACCCCAAAAAGG + Intergenic
1011114771 6:83877858-83877880 TAATTTGGAGAACCCCAAGCAGG - Intronic
1014334479 6:120115784-120115806 TAGGTTGGAAAAACCCAAACAGG - Intergenic
1014483762 6:121973304-121973326 TACTTTGGAGAGACCAAAAGGGG - Intergenic
1014569808 6:122995797-122995819 TAATTTAGAAAACACCAGAGTGG - Intergenic
1016352946 6:143187407-143187429 TTCTGTGTAAAAGCCCAAAGTGG - Intronic
1017528693 6:155266310-155266332 GGCTTTGGAAAAGCCCCAAGAGG - Intronic
1017874368 6:158512620-158512642 TTCTTTGAAAAACACCAAAAAGG - Intergenic
1018085618 6:160298808-160298830 TACTTTGCTTAACCCCAAAGGGG + Intergenic
1020856729 7:13436381-13436403 TACTGTGAAAAACACCACAGAGG - Intergenic
1024046314 7:45587935-45587957 TCCTTTGGAAAAGCACAAAATGG - Intronic
1026164983 7:67901552-67901574 AACACAGGAAAACCCCAAAGTGG + Intergenic
1034113739 7:148563742-148563764 GACTCTGGTAAAACCCAAAGGGG - Intergenic
1034511842 7:151541980-151542002 CACTTTGGAAACCACCAAAGTGG + Intergenic
1034521294 7:151622313-151622335 TATATTGCAAAACCCCAAAGAGG - Intronic
1036237911 8:7057383-7057405 TACTTTGATATTCCCCAAAGTGG - Intergenic
1039080147 8:33726200-33726222 AACTTAGGAAAACTCCACAGAGG - Intergenic
1039353761 8:36792971-36792993 TAATTTGAAAAACCCAAATGTGG + Intronic
1040690438 8:49931040-49931062 GACTTTGCAATTCCCCAAAGAGG + Intronic
1040733304 8:50475750-50475772 AAGTTTGGAAAATCCCAGAGTGG + Intronic
1041760797 8:61364018-61364040 GACTTTGGAAACCTCCAAAGGGG + Intronic
1047133493 8:122049925-122049947 TACTTTGTTATCCCCCAAAGAGG + Intergenic
1047658624 8:127007199-127007221 TATTTTGAAAAATCCCAAAGAGG + Intergenic
1048872847 8:138813121-138813143 GACTCAGGAAGACCCCAAAGAGG - Intronic
1050316453 9:4406542-4406564 TACTTGGAAAAACACTAAAGAGG + Intergenic
1050452589 9:5798830-5798852 TACCAAGGAAAACCACAAAGAGG + Exonic
1051802619 9:20953320-20953342 TACTTTGGAAAGGGCCAAATGGG - Intronic
1052072649 9:24101459-24101481 TCCTTTGGAAATCCCAGAAGTGG + Intergenic
1052811580 9:33065621-33065643 TACCTTGCAAAACTCCAAAAAGG + Intronic
1055569728 9:77604377-77604399 CACTTTGGTAAAGCCCTAAGTGG + Intronic
1055727067 9:79241973-79241995 AATTTTAGAAAATCCCAAAGGGG + Intergenic
1056092877 9:83221556-83221578 TACTTTGGAAAACACTAAACTGG + Intergenic
1058192257 9:101933145-101933167 TGCTTGCTAAAACCCCAAAGAGG + Intergenic
1059100662 9:111469039-111469061 TACTTGGCAAAACCCAAATGAGG + Intronic
1203617736 Un_KI270749v1:83828-83850 GTCTTTGCAAAAACCCAAAGAGG - Intergenic
1187945135 X:24418930-24418952 TATTTTTAATAACCCCAAAGTGG + Intergenic
1188293239 X:28414614-28414636 GACTTTGGATAACTCAAAAGTGG + Intergenic
1189145992 X:38655275-38655297 CATTTTGGAAAAGCACAAAGAGG - Intronic
1191951496 X:66598303-66598325 TACTTTAGAAGAACCTAAAGTGG + Intronic
1194277965 X:91910969-91910991 TATTTTAGAAAACCTAAAAGCGG + Intronic
1194427711 X:93760457-93760479 TACTGTTGAAAACCTCAAAGAGG + Intergenic
1197360419 X:125495182-125495204 TATTTTGGAAATGTCCAAAGAGG + Intergenic
1200227571 X:154427453-154427475 TGCTTAGGGAAACCCCCAAGTGG - Intergenic
1200595301 Y:5133041-5133063 TATTTTAGAAAACCTAAAAGCGG + Intronic
1201311693 Y:12603382-12603404 TACGGTGCAAAAACCCAAAGAGG - Intergenic
1202243234 Y:22791490-22791512 TGCAGTGGAAAAACCCAAAGAGG + Intergenic
1202396221 Y:24425240-24425262 TGCAGTGGAAAAACCCAAAGAGG + Intergenic
1202474563 Y:25244852-25244874 TGCAGTGGAAAAACCCAAAGAGG - Intergenic