ID: 907433550

View in Genome Browser
Species Human (GRCh38)
Location 1:54429371-54429393
Sequence TTTTATCTATTCCTGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907433550_907433553 2 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433553 1:54429396-54429418 GAATGGCCTGTAGCTCAGTGTGG No data
907433550_907433556 11 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433556 1:54429405-54429427 GTAGCTCAGTGTGGCTGCTCGGG No data
907433550_907433559 28 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG No data
907433550_907433557 24 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433557 1:54429418-54429440 GCTGCTCGGGAAGCTGCATGAGG No data
907433550_907433558 27 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433558 1:54429421-54429443 GCTCGGGAAGCTGCATGAGGAGG No data
907433550_907433555 10 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433555 1:54429404-54429426 TGTAGCTCAGTGTGGCTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907433550 Original CRISPR TTTTATCTATTCCTGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr