ID: 907433551

View in Genome Browser
Species Human (GRCh38)
Location 1:54429378-54429400
Sequence CATTCTCTTTTATCTATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907433551_907433559 21 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG No data
907433551_907433553 -5 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433553 1:54429396-54429418 GAATGGCCTGTAGCTCAGTGTGG No data
907433551_907433556 4 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433556 1:54429405-54429427 GTAGCTCAGTGTGGCTGCTCGGG No data
907433551_907433555 3 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433555 1:54429404-54429426 TGTAGCTCAGTGTGGCTGCTCGG No data
907433551_907433557 17 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433557 1:54429418-54429440 GCTGCTCGGGAAGCTGCATGAGG No data
907433551_907433561 29 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433561 1:54429430-54429452 GCTGCATGAGGAGGGAGGAATGG No data
907433551_907433560 24 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433560 1:54429425-54429447 GGGAAGCTGCATGAGGAGGGAGG No data
907433551_907433558 20 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433558 1:54429421-54429443 GCTCGGGAAGCTGCATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907433551 Original CRISPR CATTCTCTTTTATCTATTCC TGG (reversed) Intergenic
No off target data available for this crispr