ID: 907433554

View in Genome Browser
Species Human (GRCh38)
Location 1:54429402-54429424
Sequence GAGCAGCCACACTGAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907433554_907433560 0 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433560 1:54429425-54429447 GGGAAGCTGCATGAGGAGGGAGG No data
907433554_907433562 12 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433562 1:54429437-54429459 GAGGAGGGAGGAATGGCTAATGG No data
907433554_907433564 25 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433564 1:54429450-54429472 TGGCTAATGGAGAGGCCCGTAGG No data
907433554_907433559 -3 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG No data
907433554_907433565 26 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433565 1:54429451-54429473 GGCTAATGGAGAGGCCCGTAGGG No data
907433554_907433563 17 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433563 1:54429442-54429464 GGGAGGAATGGCTAATGGAGAGG No data
907433554_907433561 5 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433561 1:54429430-54429452 GCTGCATGAGGAGGGAGGAATGG No data
907433554_907433557 -7 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433557 1:54429418-54429440 GCTGCTCGGGAAGCTGCATGAGG No data
907433554_907433558 -4 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433558 1:54429421-54429443 GCTCGGGAAGCTGCATGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907433554 Original CRISPR GAGCAGCCACACTGAGCTAC AGG (reversed) Intergenic
No off target data available for this crispr