ID: 907433559

View in Genome Browser
Species Human (GRCh38)
Location 1:54429422-54429444
Sequence CTCGGGAAGCTGCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907433551_907433559 21 Left 907433551 1:54429378-54429400 CCAGGAATAGATAAAAGAGAATG No data
Right 907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG No data
907433550_907433559 28 Left 907433550 1:54429371-54429393 CCAGGCACCAGGAATAGATAAAA No data
Right 907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG No data
907433554_907433559 -3 Left 907433554 1:54429402-54429424 CCTGTAGCTCAGTGTGGCTGCTC No data
Right 907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907433559 Original CRISPR CTCGGGAAGCTGCATGAGGA GGG Intergenic
No off target data available for this crispr