ID: 907434161

View in Genome Browser
Species Human (GRCh38)
Location 1:54433438-54433460
Sequence CTGTCTCTACGGAGGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907434161_907434168 11 Left 907434161 1:54433438-54433460 CCAGCTTTCCTCCGTAGAGACAG No data
Right 907434168 1:54433472-54433494 ACTTGTCGGGTATCCGTTTTAGG No data
907434161_907434171 28 Left 907434161 1:54433438-54433460 CCAGCTTTCCTCCGTAGAGACAG No data
Right 907434171 1:54433489-54433511 TTTAGGGAACCATGATGAAAAGG No data
907434161_907434165 -2 Left 907434161 1:54433438-54433460 CCAGCTTTCCTCCGTAGAGACAG No data
Right 907434165 1:54433459-54433481 AGTGCCCACAGTCACTTGTCGGG No data
907434161_907434164 -3 Left 907434161 1:54433438-54433460 CCAGCTTTCCTCCGTAGAGACAG No data
Right 907434164 1:54433458-54433480 CAGTGCCCACAGTCACTTGTCGG No data
907434161_907434169 12 Left 907434161 1:54433438-54433460 CCAGCTTTCCTCCGTAGAGACAG No data
Right 907434169 1:54433473-54433495 CTTGTCGGGTATCCGTTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907434161 Original CRISPR CTGTCTCTACGGAGGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr