ID: 907437975

View in Genome Browser
Species Human (GRCh38)
Location 1:54461849-54461871
Sequence CCTGCAGTGAATGCCAGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907437970_907437975 -3 Left 907437970 1:54461829-54461851 CCAAGCTAGGGCTGCCGTGCCCT No data
Right 907437975 1:54461849-54461871 CCTGCAGTGAATGCCAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907437975 Original CRISPR CCTGCAGTGAATGCCAGCAT GGG Intergenic
No off target data available for this crispr