ID: 907438624

View in Genome Browser
Species Human (GRCh38)
Location 1:54464953-54464975
Sequence AGCTCTGGCAGAGCAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907438621_907438624 -4 Left 907438621 1:54464934-54464956 CCTGGAAAGGCCTTGTCTGAGCT No data
Right 907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG No data
907438615_907438624 30 Left 907438615 1:54464900-54464922 CCCTGCATAGTCAGGTGAGGAAA No data
Right 907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG No data
907438616_907438624 29 Left 907438616 1:54464901-54464923 CCTGCATAGTCAGGTGAGGAAAT No data
Right 907438624 1:54464953-54464975 AGCTCTGGCAGAGCAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907438624 Original CRISPR AGCTCTGGCAGAGCAGTCAC AGG Intergenic
No off target data available for this crispr