ID: 907438848

View in Genome Browser
Species Human (GRCh38)
Location 1:54465953-54465975
Sequence GGGGAACCACTATGAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907438840_907438848 20 Left 907438840 1:54465910-54465932 CCACAGCAAGTTATTCTCAATGC No data
Right 907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG No data
907438844_907438848 -2 Left 907438844 1:54465932-54465954 CCACATGAGGTTCTAGGGACTGG No data
Right 907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG No data
907438838_907438848 28 Left 907438838 1:54465902-54465924 CCCGGGTTCCACAGCAAGTTATT No data
Right 907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG No data
907438839_907438848 27 Left 907438839 1:54465903-54465925 CCGGGTTCCACAGCAAGTTATTC No data
Right 907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907438848 Original CRISPR GGGGAACCACTATGAATAAA AGG Intergenic
No off target data available for this crispr