ID: 907439901

View in Genome Browser
Species Human (GRCh38)
Location 1:54472719-54472741
Sequence GCTGCTGGGGAGCCATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907439897_907439901 -10 Left 907439897 1:54472706-54472728 CCTCTGTGATATGGCTGCTGGGG No data
Right 907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG No data
907439892_907439901 23 Left 907439892 1:54472673-54472695 CCTCAGCTGGTCAGGCAGGACAC No data
Right 907439901 1:54472719-54472741 GCTGCTGGGGAGCCATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907439901 Original CRISPR GCTGCTGGGGAGCCATGGGC TGG Intergenic
No off target data available for this crispr