ID: 907440401

View in Genome Browser
Species Human (GRCh38)
Location 1:54475016-54475038
Sequence CTGGGAGGCGGCGGAGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907440401_907440416 30 Left 907440401 1:54475016-54475038 CCGGCTCCTCCGCCGCCTCCCAG No data
Right 907440416 1:54475069-54475091 CCGGGCCCGCCGCAGAGCAAAGG No data
907440401_907440410 11 Left 907440401 1:54475016-54475038 CCGGCTCCTCCGCCGCCTCCCAG No data
Right 907440410 1:54475050-54475072 CGGCTGCTCCCTCCGAGATCCGG No data
907440401_907440411 12 Left 907440401 1:54475016-54475038 CCGGCTCCTCCGCCGCCTCCCAG No data
Right 907440411 1:54475051-54475073 GGCTGCTCCCTCCGAGATCCGGG No data
907440401_907440405 -9 Left 907440401 1:54475016-54475038 CCGGCTCCTCCGCCGCCTCCCAG No data
Right 907440405 1:54475030-54475052 GCCTCCCAGCATAGTGACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907440401 Original CRISPR CTGGGAGGCGGCGGAGGAGC CGG (reversed) Intergenic
No off target data available for this crispr