ID: 907440577

View in Genome Browser
Species Human (GRCh38)
Location 1:54475825-54475847
Sequence CTTACTAGGGTGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907440577_907440591 22 Left 907440577 1:54475825-54475847 CCACCCACCCTCACCCTAGTAAG No data
Right 907440591 1:54475870-54475892 GACAGTTTTGCCCCAGTGCTGGG No data
907440577_907440590 21 Left 907440577 1:54475825-54475847 CCACCCACCCTCACCCTAGTAAG No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907440577 Original CRISPR CTTACTAGGGTGAGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr