ID: 907440577 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:54475825-54475847 |
| Sequence | CTTACTAGGGTGAGGGTGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907440577_907440591 | 22 | Left | 907440577 | 1:54475825-54475847 | CCACCCACCCTCACCCTAGTAAG | No data | ||
| Right | 907440591 | 1:54475870-54475892 | GACAGTTTTGCCCCAGTGCTGGG | No data | ||||
| 907440577_907440590 | 21 | Left | 907440577 | 1:54475825-54475847 | CCACCCACCCTCACCCTAGTAAG | No data | ||
| Right | 907440590 | 1:54475869-54475891 | AGACAGTTTTGCCCCAGTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907440577 | Original CRISPR | CTTACTAGGGTGAGGGTGGG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||