ID: 907440590

View in Genome Browser
Species Human (GRCh38)
Location 1:54475869-54475891
Sequence AGACAGTTTTGCCCCAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907440581_907440590 14 Left 907440581 1:54475832-54475854 CCCTCACCCTAGTAAGCGGACAG No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440586_907440590 -9 Left 907440586 1:54475855-54475877 CCAGGATCCCAACCAGACAGTTT No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440574_907440590 28 Left 907440574 1:54475818-54475840 CCTCCCTCCACCCACCCTCACCC No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440580_907440590 17 Left 907440580 1:54475829-54475851 CCACCCTCACCCTAGTAAGCGGA No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440584_907440590 8 Left 907440584 1:54475838-54475860 CCCTAGTAAGCGGACAGCCAGGA No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440577_907440590 21 Left 907440577 1:54475825-54475847 CCACCCACCCTCACCCTAGTAAG No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440576_907440590 24 Left 907440576 1:54475822-54475844 CCTCCACCCACCCTCACCCTAGT No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440585_907440590 7 Left 907440585 1:54475839-54475861 CCTAGTAAGCGGACAGCCAGGAT No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440578_907440590 18 Left 907440578 1:54475828-54475850 CCCACCCTCACCCTAGTAAGCGG No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440582_907440590 13 Left 907440582 1:54475833-54475855 CCTCACCCTAGTAAGCGGACAGC No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data
907440575_907440590 25 Left 907440575 1:54475821-54475843 CCCTCCACCCACCCTCACCCTAG No data
Right 907440590 1:54475869-54475891 AGACAGTTTTGCCCCAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907440590 Original CRISPR AGACAGTTTTGCCCCAGTGC TGG Intergenic
No off target data available for this crispr