ID: 907441072

View in Genome Browser
Species Human (GRCh38)
Location 1:54478760-54478782
Sequence GAGATCTCTCTCTTCTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907441069_907441072 9 Left 907441069 1:54478728-54478750 CCAATGCTGGCTTAGATACTCTT No data
Right 907441072 1:54478760-54478782 GAGATCTCTCTCTTCTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907441072 Original CRISPR GAGATCTCTCTCTTCTATAA AGG Intergenic
No off target data available for this crispr