ID: 907441588

View in Genome Browser
Species Human (GRCh38)
Location 1:54481873-54481895
Sequence TTGGACTCAGGTACTGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907441580_907441588 30 Left 907441580 1:54481820-54481842 CCTGACCTTCCCTGATGCACTCA No data
Right 907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG No data
907441584_907441588 1 Left 907441584 1:54481849-54481871 CCAGTACTTGTCATTCTGTGCCA No data
Right 907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG No data
907441582_907441588 21 Left 907441582 1:54481829-54481851 CCCTGATGCACTCACTTCAACCA No data
Right 907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG No data
907441581_907441588 25 Left 907441581 1:54481825-54481847 CCTTCCCTGATGCACTCACTTCA No data
Right 907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG No data
907441583_907441588 20 Left 907441583 1:54481830-54481852 CCTGATGCACTCACTTCAACCAG No data
Right 907441588 1:54481873-54481895 TTGGACTCAGGTACTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907441588 Original CRISPR TTGGACTCAGGTACTGCCTG AGG Intergenic
No off target data available for this crispr