ID: 907442868

View in Genome Browser
Species Human (GRCh38)
Location 1:54489396-54489418
Sequence GCAGCAAGTCCGCACCGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907442857_907442868 20 Left 907442857 1:54489353-54489375 CCTGTGCCCAGAATTGCATTCGG No data
Right 907442868 1:54489396-54489418 GCAGCAAGTCCGCACCGAGCCGG No data
907442862_907442868 13 Left 907442862 1:54489360-54489382 CCAGAATTGCATTCGGCTGGGAG No data
Right 907442868 1:54489396-54489418 GCAGCAAGTCCGCACCGAGCCGG No data
907442856_907442868 21 Left 907442856 1:54489352-54489374 CCCTGTGCCCAGAATTGCATTCG No data
Right 907442868 1:54489396-54489418 GCAGCAAGTCCGCACCGAGCCGG No data
907442861_907442868 14 Left 907442861 1:54489359-54489381 CCCAGAATTGCATTCGGCTGGGA No data
Right 907442868 1:54489396-54489418 GCAGCAAGTCCGCACCGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907442868 Original CRISPR GCAGCAAGTCCGCACCGAGC CGG Intergenic
No off target data available for this crispr