ID: 907442874

View in Genome Browser
Species Human (GRCh38)
Location 1:54489421-54489443
Sequence GCGCGCAGCGCGGGAGCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907442869_907442874 -7 Left 907442869 1:54489405-54489427 CCGCACCGAGCCGGCTGCGCGCA No data
Right 907442874 1:54489421-54489443 GCGCGCAGCGCGGGAGCCCCCGG No data
907442867_907442874 5 Left 907442867 1:54489393-54489415 CCAGCAGCAAGTCCGCACCGAGC No data
Right 907442874 1:54489421-54489443 GCGCGCAGCGCGGGAGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907442874 Original CRISPR GCGCGCAGCGCGGGAGCCCC CGG Intergenic
No off target data available for this crispr