ID: 907443076

View in Genome Browser
Species Human (GRCh38)
Location 1:54490341-54490363
Sequence GGGAAACTGAGGCCCGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4701
Summary {0: 6, 1: 127, 2: 502, 3: 1281, 4: 2785}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443076_907443083 5 Left 907443076 1:54490341-54490363 CCATCTCCGGGCCTCAGTTTCCC 0: 6
1: 127
2: 502
3: 1281
4: 2785
Right 907443083 1:54490369-54490391 CTAGAATAGTTGGTAGCAAGAGG No data
907443076_907443079 -5 Left 907443076 1:54490341-54490363 CCATCTCCGGGCCTCAGTTTCCC 0: 6
1: 127
2: 502
3: 1281
4: 2785
Right 907443079 1:54490359-54490381 TTCCCCATTTCTAGAATAGTTGG No data
907443076_907443085 15 Left 907443076 1:54490341-54490363 CCATCTCCGGGCCTCAGTTTCCC 0: 6
1: 127
2: 502
3: 1281
4: 2785
Right 907443085 1:54490379-54490401 TGGTAGCAAGAGGATGGAGAAGG No data
907443076_907443086 22 Left 907443076 1:54490341-54490363 CCATCTCCGGGCCTCAGTTTCCC 0: 6
1: 127
2: 502
3: 1281
4: 2785
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443076_907443084 9 Left 907443076 1:54490341-54490363 CCATCTCCGGGCCTCAGTTTCCC 0: 6
1: 127
2: 502
3: 1281
4: 2785
Right 907443084 1:54490373-54490395 AATAGTTGGTAGCAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443076 Original CRISPR GGGAAACTGAGGCCCGGAGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr