ID: 907443077

View in Genome Browser
Species Human (GRCh38)
Location 1:54490347-54490369
Sequence GAAATGGGGAAACTGAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443077_907443087 29 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443087 1:54490399-54490421 AGGCGTCTGGCAACTCCCAATGG No data
907443077_907443086 16 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443077_907443084 3 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443084 1:54490373-54490395 AATAGTTGGTAGCAAGAGGATGG No data
907443077_907443083 -1 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443083 1:54490369-54490391 CTAGAATAGTTGGTAGCAAGAGG No data
907443077_907443088 30 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443088 1:54490400-54490422 GGCGTCTGGCAACTCCCAATGGG No data
907443077_907443085 9 Left 907443077 1:54490347-54490369 CCGGGCCTCAGTTTCCCCATTTC No data
Right 907443085 1:54490379-54490401 TGGTAGCAAGAGGATGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443077 Original CRISPR GAAATGGGGAAACTGAGGCC CGG (reversed) Intergenic
No off target data available for this crispr