ID: 907443078

View in Genome Browser
Species Human (GRCh38)
Location 1:54490352-54490374
Sequence TTCTAGAAATGGGGAAACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443078_907443083 -6 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443083 1:54490369-54490391 CTAGAATAGTTGGTAGCAAGAGG No data
907443078_907443089 28 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443089 1:54490403-54490425 GTCTGGCAACTCCCAATGGGTGG No data
907443078_907443088 25 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443088 1:54490400-54490422 GGCGTCTGGCAACTCCCAATGGG No data
907443078_907443085 4 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443085 1:54490379-54490401 TGGTAGCAAGAGGATGGAGAAGG No data
907443078_907443084 -2 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443084 1:54490373-54490395 AATAGTTGGTAGCAAGAGGATGG No data
907443078_907443087 24 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443087 1:54490399-54490421 AGGCGTCTGGCAACTCCCAATGG No data
907443078_907443086 11 Left 907443078 1:54490352-54490374 CCTCAGTTTCCCCATTTCTAGAA No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443078 Original CRISPR TTCTAGAAATGGGGAAACTG AGG (reversed) Intergenic
No off target data available for this crispr