ID: 907443080

View in Genome Browser
Species Human (GRCh38)
Location 1:54490361-54490383
Sequence TACCAACTATTCTAGAAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443080_907443088 16 Left 907443080 1:54490361-54490383 CCCCATTTCTAGAATAGTTGGTA No data
Right 907443088 1:54490400-54490422 GGCGTCTGGCAACTCCCAATGGG No data
907443080_907443085 -5 Left 907443080 1:54490361-54490383 CCCCATTTCTAGAATAGTTGGTA No data
Right 907443085 1:54490379-54490401 TGGTAGCAAGAGGATGGAGAAGG No data
907443080_907443086 2 Left 907443080 1:54490361-54490383 CCCCATTTCTAGAATAGTTGGTA No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data
907443080_907443089 19 Left 907443080 1:54490361-54490383 CCCCATTTCTAGAATAGTTGGTA No data
Right 907443089 1:54490403-54490425 GTCTGGCAACTCCCAATGGGTGG No data
907443080_907443087 15 Left 907443080 1:54490361-54490383 CCCCATTTCTAGAATAGTTGGTA No data
Right 907443087 1:54490399-54490421 AGGCGTCTGGCAACTCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443080 Original CRISPR TACCAACTATTCTAGAAATG GGG (reversed) Intergenic
No off target data available for this crispr