ID: 907443081

View in Genome Browser
Species Human (GRCh38)
Location 1:54490362-54490384
Sequence CTACCAACTATTCTAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907443081_907443085 -6 Left 907443081 1:54490362-54490384 CCCATTTCTAGAATAGTTGGTAG No data
Right 907443085 1:54490379-54490401 TGGTAGCAAGAGGATGGAGAAGG No data
907443081_907443089 18 Left 907443081 1:54490362-54490384 CCCATTTCTAGAATAGTTGGTAG No data
Right 907443089 1:54490403-54490425 GTCTGGCAACTCCCAATGGGTGG No data
907443081_907443087 14 Left 907443081 1:54490362-54490384 CCCATTTCTAGAATAGTTGGTAG No data
Right 907443087 1:54490399-54490421 AGGCGTCTGGCAACTCCCAATGG No data
907443081_907443088 15 Left 907443081 1:54490362-54490384 CCCATTTCTAGAATAGTTGGTAG No data
Right 907443088 1:54490400-54490422 GGCGTCTGGCAACTCCCAATGGG No data
907443081_907443086 1 Left 907443081 1:54490362-54490384 CCCATTTCTAGAATAGTTGGTAG No data
Right 907443086 1:54490386-54490408 AAGAGGATGGAGAAGGCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907443081 Original CRISPR CTACCAACTATTCTAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr